La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Amélioration des défenses de la vigne contre ses maladies - équipe « Résistance Dérivée du.

Présentations similaires


Présentation au sujet: "P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Amélioration des défenses de la vigne contre ses maladies - équipe « Résistance Dérivée du."— Transcription de la présentation:

1 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Amélioration des défenses de la vigne contre ses maladies - équipe « Résistance Dérivée du Pathogène » (RDP) C. Demuyter, S. Bruisson, J. Ocaña, L. Deglène-Benbrahim, C. Le Jeune, P. Maillot, P. Schellenbaum, L. Valat, B. Walter Université de Haute Alsace, Laboratoire Vigne, Biotechnologies et Environnement, EA-3991, BP50568, Colmar cedex 2 programmes : I. Résistance Dérivée du Pathogène (RDP) contre le GFLV, agent du court-noué de la vigne II. Programme CLOVIS : « CLOnes de VIgneS », nouveaux plants de vigne assainis, moins sensibles aux pathogènes et améliorant la qualité des vins

2 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Lutte contre le GFLV : concept de Résistance Dérivée du Pathogène Stratégie des microARNs artificiels I. Résistance Dérivée du Pathogène contre le GFLV 2 axes Validation de la stratégie sur N. benthamiana Validation de la stratégie sur Vitis vinifera Jelly 2011, d'après Antonio Garcia & Simon-Mateo 2008 Constructions (Jelly, 2011) Positions des cibles des amiARNs sur les 2 ARNs génomiques du GFLV

3 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet lignées transgéniques obtenues Agro-infiltration de la cible pour vérifier la dégradation de la cible Inoculation mécanique du GFLV pour mettre en évidence linhibition de la réplication virale Efficacité lors de létablissement de la maladie - Insertion du transgène vérifiée - Expression de lamiRNA vérifiée Détection des amiRNAs dans les lignées transgéniques de N. benthamiana (par sl-RT-PCR) Axe 1 : Validation de la stratégie sur Nicotiana benthamiana I. Résistance Dérivée du Pathogène contre le GFLV (Jelly, 2011)

4 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Co-culture dembryons (Chardonnay) avec Agrobacterium tumefaciens Transformation transitoire in vitro de la vigne Axe 2 : Validation de la stratégie sur Vitis vinifera Infiltration de vitroplants (Syrah) avec Agrobacterium tumefaciens Analyses moléculaires - sl-RT-PCR - 5RACE PCR - GUS-sensor Culture produisant des embryons somatiques Isolement de embryons somatiques dans une boîte de Pétri Dépôt dune goutte de suspension dagrobactéries sur chaque embryon Repiquage sur un milieu contenant des antibiotiques pour éliminer les agrobactéries Analyses moléculaires, 24h à 72h après Jelly N S, Schellenbaum P, Walter B, Maillot P (2012) Transgenic Research 21: I. Résistance Dérivée du Pathogène contre le GFLV Pour vérifier la dégradation de la cible Valat L, Maillot P, Gadat M, Schellenbaum P, Jelly N S, Walter B (2013) 14° Rencontres de Virologie Végétales, Janvier, Aussois, France.

5 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Transformation stable de la vigne Axe 2 : Validation de la stratégie sur Vitis vinifera - Différentes lignées transgéniques obtenues - I-PCR, TAIL-PCR, RSE-PCR (insertion du transgène) - sl-RT-PCR (expression de lamiRNA) - 5RLM-RACE PCR (dégradation de la cible) Détection des amiRNAs exprimés dans 1 lignée transgénique de vigne (par sl-RT-PCR) I. Résistance Dérivée du Pathogène contre le GFLV Analyses moléculaires Posters RVVS : Laure Valat, Pascale Maillot, Noémie S. Jelly, Paul Schellenbaum, Bernard Walter. Validation par expression transitoire dans la vigne damiRNAs dirigés contre le GFLV : tests GUS-sensor. Laurence Deglène-Benbrahim, Noémie Jelly, Paul Schellenbaum, Christine Le-Jeune, Bernard Walter, Pascale Maillot. Transformation stable de porte-greffes de vigne pour lexpression damiRNAs dirigés contre le GFLV. (Jelly, 2011)

6 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Projet ( ) : - labellisé par le pôle de compétitivité VITAGORA (Dijon) - soutenu par le Fonds Unique Interministériel & OSEO Consortium regroupant : - Pépinières Viticoles Guillaume (Charcenne, 71) - SEDIAG - Anticorps et Diagnostics (Dijon, 21) - Association Technique Viticole de Bourgogne (ATVB, Beaune, 21) - Equipe RDP du LVBE II. Programme CLOVIS « CLOnes de VIgneS », nouveaux plants de vigne assainis, moins sensibles aux pathogènes et améliorant la qualité des vins

7 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet objectifs dinnovation stratégique : - développer une méthode plus sensible de diagnostic des pathologies de la vigne - produire des plants assainis et moins sensibles aux pathogènes : mycorhizés et/ou producteurs de resvératrol - accroître la diversité de loffre accessible aux viticulteurs en développant et produisant de nouvelles vignes Deux axes de recherche – développement pour notre équipe Axe 1 : Sélection clonale et sanitaire de la vigne (Pinot Noir) Axe 2 : Effet de la mycorhization sur la stimulation des défenses de la vigne II. Programme CLOVIS

8 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Origine de la diversité génétique chez la vigne : - altérations génétiques (changements dans la séquence dADN) - altérations épigénétiques (variations non codées par la séquence dADN modifiant lexpression des gènes) Clone 1 AACCAGTAACCAGT AATGCTGCCGGATGC Clone 2 AACTAGTAACCAGTGATCGATAATGCTGCCGGATGC SNPInsertion/Délétion Méthylation (C) Me II. Programme CLOVIS But : étude de la variabilité génétique et épigénétique de clones de Pinot Noir - évaluer la diversité de clones (marqueurs moléculaires « neutres ») - définir des technique(s) fiable(s) et informative(s) pour visualiser les variations et permettant la distinction clonale (« technique de routine ») Axe 1 : Sélection clonale et sanitaire de la vigne (Pinot Noir)

9 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Technique de marquage moléculaire : MSAP : Methylation Sensitive Amplified Polymorphism (Etude réalisée sur 40 clones, agréés et nouvelles obtentions) Axe 1 : Sélection clonale et sanitaire de la vigne (Pinot Noir) II. Programme CLOVIS Résultats - Présence de bandes polymorphes stables et instables - 9 combinaisons damorces; 23 marqueurs polymorphes stables - 38 profils distincts (37 uniques et 1 partagé par 3 clones) distinction épigénétique des clones Ocaña et al, 2013, Molecular Biotechnology, DOI /s

10 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Symbioses mycorhiziennes arbusculaires - tolérance aux stress biotiques et abiotiques But : => Produire des plants de vigne mycorhizés moins sensibles aux pathogènes II. Programme CLOVIS Etudes réalisées : - contrôle de linstallation de la mycorhization - analyse de lexpression de gènes marqueurs de défense * après élicitation * suite à linoculation de pathogènes - mesure de lévolution des teneurs en stilbènes Axe 2 : Effet de la mycorhization sur la stimulation des défenses de la vigne Suivi de la mycorhization : Inoplant Dijon Champignon mycorhizogène à arbuscules dans un système racinaire

11 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 II. Programme CLOVIS Recherche de gènes potentialisés par la mycorhization (marqueurs de « priming ») - Éliciteurs chimiques (voie SA et voie JA/ETH) - Infection par des micro-organismes pathogènes (biotrophes et nécrotrophes) - Analyse de lexpression de gènes de défense par qPCR Axe 2 : Effet de la mycorhization sur la stimulation des défenses de la vigne Expression de gènes de défense dans des feuilles de plants de Pinot Noir mycorhizés ou non, traités avec du Bion®

12 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Etude de lexpression de gènes marqueurs de défense -Persistance du « priming » dans le temps -Suivi du taux de mycorhization -Maintien du priming de gènes de défense Etude de leffet protecteur des mycorhizes vis-à-vis de bioagresseurs - Infection par Plasmopara viticola et Botrytis cinerea II. Programme CLOVIS Axe 2 : Effet de la mycorhization sur la stimulation des défenses de la vigne Sébastien Bruisson, Pascale Maillot, Laurence Benbrahim, Armelle Gollotte, Bernard Walter, Journées francophones des mycorhizes 2012, 5-7 sept, Nancy, France. Sébastien Bruisson, Pascale Maillot, Laurence Benbrahim, Armelle Gollotte, Bernard Walter, st world congress on the use of biostimulants in agriculture, nov, Strasbourg, France. Feuille de Pinot Noir infectée par Botrytis cinerea

13 P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 II. Programme CLOVIS Poster RVVS Axe 1 : Sélection clonale et sanitaire de la vigne (Pinot Noir) Juan Ocaña, Bernard Walter, Paul Schellenbaum. Distinction of Vitis vinifera cv Pinot noir clones by stable MSAP markers. Axe 2 : Effet de la mycorhization sur la stimulation des défenses de la vigne Sébastien Bruisson, Pascale Maillot, Laurence Deglène-Benbrahim, Armelle Gollotte, Bernard Walter. Effet de la mycorhization sur lexpression des gènes de défense de la vigne après élicitation chimique ou inoculation de pathogènes.


Télécharger ppt "P. Schellenbaum – Equipe RDP du LVBE – RVVS 01 juillet 2013 Amélioration des défenses de la vigne contre ses maladies - équipe « Résistance Dérivée du."

Présentations similaires


Annonces Google