La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Alexis DereeperFormation Bio-informatique Apimet 2013 Recherche et analyse de polymorphismes SNP.

Présentations similaires


Présentation au sujet: "Alexis DereeperFormation Bio-informatique Apimet 2013 Recherche et analyse de polymorphismes SNP."— Transcription de la présentation:

1 Alexis DereeperFormation Bio-informatique Apimet 2013 Recherche et analyse de polymorphismes SNP

2 Connaître et manipuler des packages/outils disponibles pour la recherche de SNP et INDEL à partir de données NGS (assemblage de données NGS) Réfléchir sur les difficultés rencontrées liées aux nouvelles technologies de séquençage (différencier erreur de séquençage, paralogues et variation allélique) Détecter les SNP et pouvoir affecter les génotypes aux différentes positions polymorphes Exploiter simplement les données de polymorphismes via une application Web (diversité génétique, DL) Obtenir un jeu de données exploitables à envoyer pour le design dune puce SNP haut-débit (technologie Illumina VeraCode) Short reads Solexa Mapping SAM Exploitation des données de polymorphismes Design de puces Illumina Assignation des génotypes Ind1 ATTGTGTCGTAACGTATGTCATGTCGT Ind2 ATTGTGTCGGAACGTATGTCATGTCGT Ind3 ATTGTGTCGKAACGTATGTCATGTCGT Variations alléliques Liste de SNP 1 A/G 1998 T/C 2341 T/G But du TP

3 Alexis Dereeper Tablet Outil graphique de visualisation dassemblage de données NGS Accepte différents formats: ACE, SAM, BAM Formation Bio-informatique Apimet 2013

4 Alexis Dereeper GATK (Genome Analysis ToolKit) Librairie logicielle pour l'analyse de données NGS. Développé pour l'analyse des projets de reséquençage médical chez l'Humain (1000 Génomes, The Cancer Genome Atlas) Inclut des outils d'analyse de profondeur, recalibrateur de score de qualité, détection de SNP/InDel Complémentaire des 2 autres packages: SamTools, PicardTools PREPROCESS: * Index human genome (Picard), we used HG18 from UCSC. * Convert Illumina reads to Fastq format * Convert Illumina 1.6 read quality scores to standard Sanger scores FOR EACH SAMPLE: 1. Align samples to genome (BWA), generates SAI files. 2. Convert SAI to SAM (BWA) 3. Convert SAM to BAM binary format (SAM Tools) 4. Sort BAM (SAM Tools) 5. Index BAM (SAM Tools) 6. Identify target regions for realignment (Genome Analysis Toolkit) 7. Realign BAM to get better Indel calling (Genome Analysis Toolkit) 8. Reindex the realigned BAM (SAM Tools) 9. Call Indels (Genome Analysis Toolkit) 10. Call SNPs (Genome Analysis Toolkit) 11. View aligned reads in BAM/BAI (Integrated Genome Viewer) Formation Bio-informatique Apimet 2013

5 Alexis Dereeper Détection automatique de SNP à partir dassemblage SAM SAM assembly FastQ Groomer Mapping BWA GATK PicardTools Fastq Exemple de chaine de traitement réalisable avec Galaxy SouthGreen: IndelRealigner UnifiedGenotyper VCF file Formation Bio-informatique Apimet 2013 DepthOfCoverage Add or Replace Groups BAM assembly including ReadGroups Depth file

6 Global BAM with read group FastQ Groomer Mapping BWA IndelRealigner UnifiedGenotyper VCF file Fastq (RC1) BAM with read group FastQ Groomer Mapping BWA Fastq (RC2) BAM with read group FastQ Groomer Mapping BWA Fastq (RC3) BAM with read group FastQ Groomer Mapping BWA Fastq (RC4) BAM with read group …. mergeSam Add or Replace Groups DepthOfCoverage Depth file

7 Alexis Dereeper Format VCF (Variant Call Format) ##fileformat=VCFv4.0 ##fileDate= ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO= ##FILTER= ##FORMAT= #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA rs G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51, T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 Avantages: description des variations pour chaque position + assignation aux génotypes Formation Bio-informatique Apimet 2013

8 Global BAM with read group FastQ Groomer Mapping BWA IndelRealigner UnifiedGenotyper VCF file Fastq (RC1) BAM with read group FastQ Groomer Mapping BWA Fastq (RC2) BAM with read group FastQ Groomer Mapping BWA Fastq (RC3) BAM with read group FastQ Groomer Mapping BWA Fastq (RC4) BAM with read group …. mergeSam Add or Replace Groups DepthOfCoverage Depth file ReadBackedPhasing VariantFiltration Phased VCF Filtered VCF

9 Alexis Dereeper Autres fonctionalités GATK Module DepthOfCoverage: Permet de renseigner de la profondeur de séquençage pour chaque gène, chaque position et chaque individu Module ReadBackedPhasing: Permet de définir dans la mesure du possible les associations dallèles (phase ou haplotype) quand il y a hétérozygotie… Et non AGG GGA Formation Bio-informatique Apimet 2013

10 Alexis Dereeper SNiPlay: application Web pour lanalyse du polymorphisme Formation Bio-informatique Apimet 2013

11 Global BAM with read group FastQ Groomer Mapping BWA IndelRealigner UnifiedGenotyper VCF file Fastq (RC1) BAM with read group FastQ Groomer Mapping BWA Fastq (RC2) BAM with read group FastQ Groomer Mapping BWA Fastq (RC3) BAM with read group FastQ Groomer Mapping BWA Fastq (RC4) BAM with read group …. mergeSam Add or Replace Groups DepthOfCoverage Depth file

12 Options de SNiPlay Cocher format VCF Charger fichier VCF Charger référence Sélectionner génome du Riz Charger fichier de profondeur

13 Alexis Dereeper Coordonnées cartésiennes Fichier de génotypage Fichier de soumission pour Illumina Analyse avec le logiciel BeadStudio Design de puces Illumina Formation Bio-informatique Apimet 2013

14 Alexis Dereeper Individu, group Ind1, Table Ind2, Table Ind3, Table Ind4, East Ind5, East Ind6, East Ind7, East Ind8, West External file (optional) Partage dallèles entre groupes Formation Bio-informatique Apimet 2013

15 Alexis Dereeper Annotation des SNPs Formation Bio-informatique Apimet 2013

16 Alexis Dereeper Annotation des SNPs Formation Bio-informatique Apimet 2013

17 Alexis ALLELIC N° P SSSSSSSSSS #cARB A A G G T C C A T T #cSYR A A G A T C C A T C A A G G T C C A T T Format PED Format DARwin Format.inp pour Phase Format pour TASSEL (génétique dassociation) cARB cSYR cARA : cARBA:AA:AG:GG:GT:TC:CC:CA:AT:TT:T cSYRA:AA:AG:GA:GT:TC:CC:CA:AT:TC:T cARAA:AA:AG:GG:GT:TC:CC:CA:AT:TT:T cORLA:AA:AG:GG:GT:TC:CC:CA:AT:TT:T cLARA:GA:GA:GA:GC:TC:CC:CA:AT:TC:T Fichiers alléliques Formation Bio-informatique Apimet 2013

18 Librairie SeqLib Analyse de diversité

19 Alexis Dereeper Réseaux dhaplotypes Haplotypes fréquents Haplotype peu fréquent Distribution des groupes Au sein de cet haplotype Distance séparant les 2 haplotypes (nb de mutations) Formation Bio-informatique Apimet 2013


Télécharger ppt "Alexis DereeperFormation Bio-informatique Apimet 2013 Recherche et analyse de polymorphismes SNP."

Présentations similaires


Annonces Google