La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Laurent Bianchetti Plate-forme Bioinformatique de Strasbourg (BIPS) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent.

Présentations similaires


Présentation au sujet: "Laurent Bianchetti Plate-forme Bioinformatique de Strasbourg (BIPS) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent."— Transcription de la présentation:

1 Laurent Bianchetti Plate-forme Bioinformatique de Strasbourg (BIPS) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent Fries Illkirch France 1 5, 12, 20 et 21 Décembre 2012 Institut Universitaire de Technologie de Colmar Génie biologique

2 2 Partie III

3 1) Intro/définitions (génome, transcriptome, etc …) 2) Génomique 3) Transcriptomique (4) Protéomique)

4 Le génome Le transcriptome Le protéome Le métabolome Le methylome Lexome

5 Objet biologiqueDiscipline scientifique GénomeGénomique Discipline qui étudie la séquence dun génome (annotation) selon une approche globale (gènes, séquences répétées, etc …) Génomique comparative Discipline qui étudie lévolution des séquences génomiques entre organismes selon une approche globale Génomique fonctionnelle Discipline qui étudie la fonction des gènes dun génome selon une approche globale TranscriptomeTranscriptomique (mRNA, miRNA, etc …) Discipline qui étudie les séquences dARN exprimées dans les cellules et les niveaux dexpression selon une approche globale ProtéomeProtéomique Discipline qui étudie les modifications post-traductionnelles des protéines exprimées dans les cellules selon une approche globale Disciplines scientifiques de la biologie globale

6 6 Nucleic sequence (finished or draft) Annotations (coordinates) (ORFs, non-codant genes, pseudo-genes, Regulatory elements, CpG island, anything ….) Genome

7 7 Sequence comparisons using BLAT Sequence comparisons using Blast, Blastx, tBlastn Sequence comparisons using Blast, Blastx, tBlastn

8 8

9 AffymetrixAgilentIllumina Cette méthode est basée sur lhybridation de cDNA (cRNA) sur des sondes oligonucléotidiques spécifiques fixées sur un support (Biopuce) Lintensité dun fluorochrome (Cy3 ou Cy5) est corrélée au niveau dexpression du transcrit dans la cellule Lanalyse des micro-arrays demande des connaissances en statistiques

10 Les expériences transcriptomiques sont centralisées chez GEO

11 11

12 12 DMSODRUG 24 BR1BR2BR1BR2 CY3CY5CY3CY5CY3CY5CY3CY5 DMSO24BR1Cy31,0000,8950,7400,7480,8990,8030,6980,712 Cy50,8951,0000,7140,7950,8480,8970,6770,761 BR2Cy30,7400,7141,0000,8440,7510,6420,7720,690 Cy50,7480,7950,8441,0000,7480,7700,7370,775 DRUGBR1Cy30,8990,8480,7510,7481,0000,8800,8210,818 Cy50,8030,8970,6420,7700,8801,0000,7310,832 BR2Cy30,6980,6770,7720,7370,8210,7311,0000,900 Cy50,7120,7610,6900,7750,8180,8320,9001,000

13 13

14 14 La heatmap représente les fold change des gènes différentiellement exprimés

15 15 Down regulationUp regulation

16 16 Séquenceur Illumina Genome Analyzer IIx Fichiers.fastq-illumina ~30 millions de reads par échantillons 54 base reads Séquenceur Illumina HiSeq2000 Fichiers.fastq-illumina ~200 millions de reads par échantillons Séquenceurs produisant des séquences courtes ome_analyzer_iix.ilmn

17 Séquenceur Roche 454 Séquenceurs produisant des séquences longues (300 à >1000 bases) PacBio Pacific Bioscience

18 MéthodeApplicationIntérêt pour la recherche DNA-seq Séquençage de génome de novo (bactéries, archae, eucaryotes) Etude de lévolution des organismes Exome- seq Séquençage de lexome dun individuEtude des maladies génétiques (recherche de mutation) ChIP-seq (Chromatine immunopreci -pitation) Séquençage des régions de lADN génomique qui se lient à une protéine dintérêt Etude de la régulation de lexpression des gènes Methyl-seq Identification des régions du génome qui sont méthylées Etude de la régulation de lexpression des gènes 5-C capture (Chromosome Conformation Capture Carbon Copy) Séquençage de régions dADN génomiques qui sont en proximité dans la structure 3D des chromosomes Annotation du génome et étude de lexpression des gènes

19 Protocole du ChIP-seq

20 Nom RNA-seqSéquençage des ARNm poly-adénylés en 3 Etude du transcriptome (transcrits, isoformes, variation des niveaux dexpression) smallRNA-seqSéquençage des « petits » ARN (micro-ARN) Rôle des petits ARN dans la régulation de lexpression des gènes

21 5-C capture (Chromosome Conformation Capture Carbon Copy) Séquençage de régions dADN génomiques qui sont en proximité dans la structure 3D des chromosomes Annotation du génome et étude de lexpression des gènes

22 22 SAGE, Victor Velculescu 10 base tags, 1000 tags per sample standard longSAGE experiment 17 base tags, tags (Saha et al) ESC longSAGE library tags Marco Marra (Vancouver) RNA-seq Illumina Genome analyzer II reads RNA-seq HiSeq reads standard SAGE experiment tags Illumina Solexa Tag-seq 3 to 6 million tags Marco Marra (Vancouver) 2009 Evolution des méthode de profilage dexpression de gènes par tag ou reads

23 23

24 Des Giga, Tera, Peta bytes de données sont produites par la biologie omique

25 @identifiant_de_sequence GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%++)(%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 >identifiant_de_sequence GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT Phred score = -10 log 10 Pe

26 QC 1 = Phred scores le long des reads

27 QC 2 = composition en base

28 Il sagit de programmes qui alignent des reads sur le génome en un temps record Les plus utilisés sont bowtie1 (ungapped) et bwa (gapped) La séquence génomique est préalablement Indexée

29 UBSM = unique best scoring match

30

31 1) Quantification Les reads sont associés aux gènes 2)Normalisation des niveaux dexpression (ex: RPKM) reads par kilobase dexon et par million 3) Test statistique pour détecter Des variations significative entre Control et condition 4) Correction multi-test (FDR) Liste de gènes up et down régulés

32 Micro-arraysLicence R, bioconductorAcadémiqueLigne de commande GeneSpring GXCommercialGraphique PartekCommercialGraphique NGS bowtie, bwa, samtools, picard, megablast, etc … AcadémiqueLigne de commande GALAXYAcadémiqueWeb NGS AvadisCommercialGraphique GeneSpring NGSCommercialGraphique Partek Genomic SuiteCommercialGraphique


Télécharger ppt "Laurent Bianchetti Plate-forme Bioinformatique de Strasbourg (BIPS) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent."

Présentations similaires


Annonces Google