La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Bioinformatique Laurent Bianchetti

Présentations similaires


Présentation au sujet: "Bioinformatique Laurent Bianchetti"— Transcription de la présentation:

1 Bioinformatique Laurent Bianchetti
Plate-forme Bioinformatique de Strasbourg (BIPS) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent Fries 67404 Illkirch France 5, 12, 20 et 21 Décembre 2012 Institut Universitaire de Technologie de Colmar Génie biologique

2 Bioinformatique appliquée à la biologie globale ou « Omique »
Partie III Bioinformatique appliquée à la biologie globale ou « Omique »

3 Plan du cours 1) Intro/définitions (génome, transcriptome, etc …)
2) Génomique 3) Transcriptomique (4) Protéomique)

4 Définitions Le génome L’exome Le transcriptome Le protéome
Le métabolome Le methylome

5 Disciplines scientifiques de la biologie globale
Objet biologique Discipline scientifique Génome Génomique Discipline qui étudie la séquence d’un génome (annotation) selon une approche globale (gènes, séquences répétées, etc …) Génomique comparative Discipline qui étudie l’évolution des séquences génomiques entre organismes selon une approche globale Génomique fonctionnelle Discipline qui étudie la fonction des gènes d’un génome selon une approche globale Transcriptome Transcriptomique (mRNA, miRNA, etc …) Discipline qui étudie les séquences d’ARN exprimées dans les cellules et les niveaux d’expression selon une approche globale Protéome Protéomique Discipline qui étudie les modifications post-traductionnelles des protéines exprimées dans les cellules selon une approche globale

6 Genome Banque génomiques Nucleic sequence (finished or draft)
Annotations (coordinates) (ORFs , non-codant genes, pseudo-genes, Regulatory elements, CpG island, anything ….) Genome

7 Genome servers for sequence similarity searches
Sequence comparisons using BLAT Sequence comparisons using Blast, Blastx, tBlastn Sequence comparisons using Blast, Blastx, tBlastn

8 Genome browsers for navigation

9 Analyse d’expression par micro-arrays
Affymetrix Agilent Illumina Cette méthode est basée sur l’hybridation de cDNA (cRNA) sur des sondes oligonucléotidiques spécifiques fixées sur un support (Biopuce) L’intensité d’un fluorochrome (Cy3 ou Cy5) est corrélée au niveau d’expression du transcrit dans la cellule L’analyse des micro-arrays demande des connaissances en statistiques

10 Les expériences transcriptomiques sont centralisées chez GEO

11 QC = Box plot of normalized intensities across samples

12 QC= Pearson corr. coef. Matrix
DMSO DRUG 24 BR1 BR2 CY3 CY5 Cy3 1,000 0,895 0,740 0,748 0,899 0,803 0,698 0,712 Cy5 0,714 0,795 0,848 0,897 0,677 0,761 0,844 0,751 0,642 0,772 0,690 0,770 0,737 0,775 0,880 0,821 0,818 0,731 0,832 0,900

13 Signature d’expression différentielles gènes UP-régulés et gènes DOWN-régulés

14 La heatmap représente les fold change
des gènes différentiellement exprimés

15 RT-PCR validation Down regulation Up regulation

16 Séquençage de nouvelle génération (NGS)
Séquenceurs produisant des séquences courtes Séquenceur Illumina Genome Analyzer IIx Séquenceur Illumina HiSeq2000 Fichiers .fastq-illumina ~30 millions de reads par échantillons 54 base reads Fichiers .fastq-illumina ~200 millions de reads par échantillons

17 Séquençage de nouvelle génération (NGS)
Séquenceurs produisant des séquences longues (300 à >1000 bases) Séquenceur Roche 454 PacBio Pacific Bioscience

18 Séquençage d’ADN génomique
Méthode Application Intérêt pour la recherche DNA-seq Séquençage de génome de novo (bactéries, archae, eucaryotes) Etude de l’évolution des organismes Exome-seq Séquençage de l’exome d’un individu Etude des maladies génétiques (recherche de mutation) ChIP-seq (Chromatine immunopreci-pitation) Séquençage des régions de l’ADN génomique qui se lient à une protéine d’intérêt Etude de la régulation de l’expression des gènes Methyl-seq Identification des régions du génome qui sont méthylées 5-C capture (Chromosome Conformation Capture Carbon Copy) Séquençage de régions d’ADN génomiques qui sont en proximité dans la structure 3D des chromosomes Annotation du génome et étude de l’expression des gènes

19 Protocole du ChIP-seq

20 Séquençage d’ARN Nom RNA-seq Séquençage des ARNm poly-adénylés en 3’
Etude du transcriptome (transcrits, isoformes, variation des niveaux d’expression) smallRNA-seq Séquençage des « petits » ARN (micro-ARN) Rôle des petits ARN dans la régulation de l’expression des gènes

21 Nouvelles applications
5-C capture (Chromosome Conformation Capture Carbon Copy) Séquençage de régions d’ADN génomiques qui sont en proximité dans la structure 3D des chromosomes Annotation du génome et étude de l’expression des gènes

22 Evolution des méthode de profilage d’expression de gènes par tag ou reads
Illumina Solexa Tag-seq 3 to 6 million tags Marco Marra (Vancouver) SAGE, Victor Velculescu 10 base tags, 1000 tags per sample standard SAGE experiment tags RNA-seq HiSeq 2000 reads 2006 2007 2009 2010 1995 2000 2012 standard longSAGE experiment 17 base tags, tags (Saha et al) RNA-seq Illumina Genome analyzer II reads ESC longSAGE library tags Marco Marra (Vancouver)

23 Omics READ repository

24 sont produites par la biologie omique
BigData Des Giga, Tera, Peta bytes de données sont produites par la biologie omique

25 Format FASTA vs. FASTQ Phred score = -10 log10 Pe
>identifiant_de_sequence GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT @identifiant_de_sequence GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Phred score = -10 log10 Pe

26 QC 1 = Phred scores le long des reads

27 QC 2 = composition en base

28 Read mappers Il s’agit de programmes qui alignent des reads sur le génome en un temps record Les plus utilisés sont bowtie1 (ungapped) et bwa (gapped) La séquence génomique est préalablement Indexée

29 UBSM = unique best scoring match

30 Genome viewer

31 Expression différentielle en RNA-seq
1) Quantification Les reads sont associés aux gènes 2)Normalisation des niveaux d’expression (ex: RPKM) reads par kilobase d’exon et par million 3) Test statistique pour détecter Des variations significative entre Control et condition 4) Correction multi-test (FDR) Liste de gènes up et down régulés

32 Logiciels d’analyse de données omiques
Micro-arrays Licence R, bioconductor Académique Ligne de commande GeneSpring GX Commercial Graphique Partek NGS bowtie, bwa, samtools, picard, megablast, etc … Académique Ligne de commande GALAXY Web NGS Avadis Commercial Graphique GeneSpring NGS Partek Genomic Suite


Télécharger ppt "Bioinformatique Laurent Bianchetti"

Présentations similaires


Annonces Google