La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

ARN késako ? Julie BERNAUERAdrien GUILHOT-GAUDEFFROY Yann PONTYMireille REGNIER EQUIPE PROJET AMIB Inria Saclay 28 Septembre 2012.

Présentations similaires


Présentation au sujet: "ARN késako ? Julie BERNAUERAdrien GUILHOT-GAUDEFFROY Yann PONTYMireille REGNIER EQUIPE PROJET AMIB Inria Saclay 28 Septembre 2012."— Transcription de la présentation:

1 ARN késako ? Julie BERNAUERAdrien GUILHOT-GAUDEFFROY Yann PONTYMireille REGNIER EQUIPE PROJET AMIB Inria Saclay 28 Septembre 2012

2 Les ARN et leur repliement Nuit des chercheurs - LIX/Inria AMIB28/09/

3 Principe central de la biologie moléculaire 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 3 ADN A T G C T A C G A T G C G C T A C G ARN Poly. AGUCAG GUC ARNm Ribosome Protéine Ala Leu Cyt Mais il existe de très nombreuses exceptions, et de très nombreux autres rôles pour lARN ! Règle : ADN (A,C,G,T) ARN (A,C,G,U) Protéine

4 Repliement des ARN ARN = un seul brin Structure très variable … … plus conservée au cours de lévolution que la séquence Diversité de fonction Fonction (partiellement) codée dans la structure Prédire le repliement de lARN 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB4

5 Les paires de bases (Canoniques) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB5 Canonical base-pairs G/C Paires Watson/Crick U/A U/G Paire Wobble

6 La structure secondaire : Une simplification raisonnable 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB6 Modèle 3D ARN ribosomal (5s) Structure secondaire Uniquement Watson/Crick (A/U et G/C) et Wobble (G/U) interditsPseudonoeuds interdits GGAG … A GC U G G U C Contraintes/Règles du jeu

7 Repliement par minimisation de lénergie libre 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 7 …CAGUAGCCGAUCGCAGCUAGCGUA… Séquence dARN Nombreuses structures secondaires Paradigme historique : dénergie libre minimale = Structure dénergie libre minimale Structure fonctionnelle = Structure compatible la plus stable Nombre maximal de paires de bases

8 Au boulot … Nuit des chercheurs - LIX/Inria AMIB28/09/

9 A vous de jouer ! 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 9 Saurez vous trouver, pour lARN ci-dessus, le repliement ayant un nombre maximal de paires de bases ? Règles : 1.Seules les paires de bases canoniques sont autorisées. 2. Les croisements et liaisons extérieures sont interdites. GAGAAGUACUUGAAAUUGGCCUCCUC AU UA GC CG GU UG

10 Solution 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 10 Ce repliement est le seul à apparier toutes les bases. Il existait repliements (partiels) valides. Comment retrouver ce repliement sans les énumérer tous ? Algorithme de programmation dynamique (Diviser pour régner + Mémorisation des résultats)

11 Le design dARN Un problème inverse Nuit des chercheurs - LIX/Inria AMIB28/09/

12 Design dARN structurés 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 12 On sait (à peu près) prédire le repliement des ARN Pourrait on sen servir pour créer de nouvelles molécules ? Design dARN : Créer une séquence se repliant en une structure secondaire prédéterminée (ex. : rôle thérapeutique). …CAGUAGCCGAUC GCAGCUAGCGUA… Prédiction du repliement Design dARN

13 A vous de jouer… 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 13 Aucun algorithme exact et efficace nest actuellement connu. Saurez vous résoudre le problème à la main ? But du jeu : Créer une séquence ARN 1.se repliant optimalement en la structure cible #maximal de paires de bases = #paires dans structure cible. 2.de façon unique pas de repliement alternatif ayant autant de paires de bases.

14 A vous de jouer… 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 14 Séquence courante Repliement visé Nombre de repliements co-optimaux (7 paires de base) Nombre de repliements co-optimaux (7 paires de base) Navigation parmis les co-optimaux Positions correctes

15 A vous de jouer… 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 15 La séquence est modifiée en cliquant sur une position

16 A vous de jouer… 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 16 Le repliement de la nouvelle séquence est calculé et affiché Le nombre de repliements co-optimaux est mis à jour La séquence est modifiée en cliquant sur une position

17 A vous de jouer… 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 17 Le repliement de la nouvelle séquence est calculé et affiché Le nombre de repliements co-optimaux est mis à jour La séquence est modifiée en cliquant sur une position La partie se termine quand le repliement est correct et unique.

18 Merci ! Questions ? AMIB Saclay

19 Algorithmique du repliement Nuit des chercheurs - LIX/Inria AMIB- 1928/09/2012

20 Nuit des chercheurs - LIX/Inria AMIB- 20

21 ? Quel cas choisir ??? 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 21

22 … ? ? ? Quel cas choisir ??? 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 22

23 … < Quel cas choisir ??? /09/2012 Nuit des chercheurs - LIX/Inria AMIB- 23

24 … … tout Quel cas choisir ??? Faut il tout essayer ? 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 24

25 tout Quel cas choisir ??? Faut il tout essayer ? 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 25

26 Quel cas choisir ??? Faut il tout essayer ? Impossible Nombre exponentiel de solutions Impossible de tout essayer !! Migraine 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 26

27 Quel cas choisir ??? Faut il tout essayer ? Impossible Nombre exponentiel de solutions Impossible de tout essayer !! Migraine 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 27

28 Quel cas choisir ??? Faut il tout essayer ? Impossible Nombre exponentiel de solutions Impossible de tout essayer !! Migraine #Atomes dans lunivers (10 80 ) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 28

29 … … Mais calcul redondant … 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 29

30 Mais calcul redondant … 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 30

31 … Solution : Diviser pour régner (Déléguer pour résoudre) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 31

32 … ? 20 ! Solution : Diviser pour régner (Déléguer pour résoudre) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 32

33 … ? 19 ! Solution : Diviser pour régner (Déléguer pour résoudre) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 33

34 … ? ? 18 ! 0 ! Solution : Diviser pour régner (Déléguer pour résoudre) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 34

35 … ? ? 16 ! 2 ! Solution : Diviser pour régner (Déléguer pour résoudre) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 35

36 … ? 19 ! Solution : Diviser pour régner (Déléguer pour résoudre) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 36

37 … ? 18 ! Solution : Diviser pour régner (Déléguer pour résoudre) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB- 37

38 Combien ça coûte ? (Programmation dynamique) ? Max( + + ) ? ? ? ? = Max Nombre de danseurs n Un assistant par région dans la ronde (n*(n-1)) / 2 n 2 Chaque assistant fait, au pire, n calculs Nombre total de calculs : A peu près n 3 … Attention à lordre des calculs (Commencer par les petites régions …) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB38

39 Combien ça coûte ? Max( + + ) ? ? ? ? = Max Nombre de danseurs n Un assistant par région dans la ronde (n*(n-1)) / 2 n 2 Chaque assistant fait, au pire, n+1 calculs Nombre total de calculs : A peu près n 3 … Attention à lordre des calculs (Commencer par les petites régions …) Migraine StratégieTout essayerDiviser pour régner Nombre de calculs ExponentielPolynomial O(n 3 ) 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB39

40 Combien ça coûte ? Max( + + ) ? ? ? ? = Max Nombre de danseurs n Un assistant par région dans la ronde (n*(n-1)) / 2 n 2 Chaque assistant fait, au pire, n+1 calculs Nombre total de calculs : A peu près n 3 … Attention à lordre des calculs (Commencer par les petites régions …) StratégieTout essayerDiviser pour régner Nombre de calculs ExponentielPolynomial O(n 3 ) Migraine 40 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB40

41 Quelques applications Nuit des chercheurs - LIX/Inria AMIB28/09/

42 Performances 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB 42

43 Evaluer la qualité dune prédiction 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB 43 Intron du groupe II (D1-D4) RFAM ID: RF02001 RNAFold [Gruber AR et al. NAR 2008]

44 Evaluer la qualité dune prédiction 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB 44 RNAFold [Gruber AR et al. NAR 2008] Intron du groupe II (D1-D4) RFAM ID: RF02001

45 Evaluer la qualité dune prédiction 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB 45 De faibles probabilités indiquent des régions incertaines BP>99% Avg. PPV>90% BP>90% PPV>83% RNAFold [Gruber AR et al. NAR 2008] Intron du groupe II (D1-D4) RFAM ID: RF02001

46 Sensibilité des ARN aux mutations 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB 46 Echantillonage Clustering PCA [Halvorsen M et al, PLOS Gen 2010]

47 Sensibilité des ARN aux mutations 28/09/2012 Nuit des chercheurs - LIX/Inria AMIB 47 Echantillonage Clustering PCA [Halvorsen M et al, PLOS Gen 2010] ?


Télécharger ppt "ARN késako ? Julie BERNAUERAdrien GUILHOT-GAUDEFFROY Yann PONTYMireille REGNIER EQUIPE PROJET AMIB Inria Saclay 28 Septembre 2012."

Présentations similaires


Annonces Google