La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Algorithmique et programmation Informatique Cours 9 12/11/2001.

Présentations similaires


Présentation au sujet: "Algorithmique et programmation Informatique Cours 9 12/11/2001."— Transcription de la présentation:

1 Algorithmique et programmation Informatique Cours 9 12/11/2001

2 Les caractères Ensemble ordonné Codage ASCII ( 7 bits: 2 7 = 128 codes ) American Standard Code for Information Interchange ASCII étendu ( 8 bits ) ISO latin-1 UNICODE ( 2 octets ) Table de collationnement

3 Les caractères (rappel) CARACTERES constantes A c 7 variables j, k: caractères corps k <-- A j <-- k

4 Les caractères (rappel) constantesz = A lecar = c chif = 7 variables j, k: caractères corps k <-- A ;j <-- k lire ( j ) ;écrire ( k > j ) écrire ( chif, lecar, z )

5 Les caractères (rappel) CARACTERES expressions lire(z) k <-- A j <-- z écrire ( k > j )

6 Les caractères Bloc caract constantec = A variablesk, z: caractères corps k <-- c lire ( z ) tant que z 0 faire écrire (k, >,z,, k > z) lire ( z ) ftant Fin bloc 1_caracteres ƒ

7 Les caractères (codage) Bloc codage variablesx, y: caractères corps x <-- A y <-- B écrire ( x, y ) Fin bloc 2_codage ƒ

8 Les caractères (fonctions) FonctionParamètreValeur Position ( a )caractèreentier Valeur_caractère ( n )entiercaractère Successeur ( a )caractère Prédécesseur ( a )caractère 2a_posval ƒ2b_test_car ƒ

9 Les caractères (suite) Exemples : Prédécesseur - successeur DNA Conversions Chaînes - concaténation

10 Les caractères: fonctions Bloc pred_succ Variable k: caractère Corps lire ( k ) tant que k 0 faire écrire (prédécesseur(k), k, successeur(k)) lire ( k ) Ftant Fin bloc 3_predsucc ƒ

11 Les caractères: application The nucleotide sequences of genes of Escherichia coli CCCGGGTTCATTGTGCGAAGGCATGGCATATTTGT TCCCGGTGTCGTCAGCAGCATAATTCGACTCTCCA TCTGCTGTGTGGCCAGACAAAAGATGGCCTTGTTT GCCGCGGTGGAAATGGAGGGAGGA… Guanine (G), Adenine (A), Thymine (T), Cytosine (C) Each set of three nucleotides represents an amino acid, or codon

12 Les caractères: application Bloc dna Variables c: caractère ; n: vecteur[1..5] d entiers corps n <-- 0 ; lire ( c ) tant que c <> ' ' faire selon que c est 'a : n 1 <-- n 'c : n 2 <-- n 'g : n 3 <-- n 't : n 4 <-- n autrement n 5 <-- n fin selon lire(c) ftant écrire(n) fbloc 4_dna ƒ

13 Les caractères: conversions Bloc conversion Typew = chaîne Variables texte: w Corps lire(texte) écrire ( lenombre(texte) ) fbloc

14 Les caractères: conversions Fonction lenombre ( t: w ): entière Variables z, k: entiers Corps z <-- 0 pour k de 1 à N faire z <-- z * 10 + position(t k ) - position ( 0 ) lenombre <-- z Fin fonction 5_conversion_1 ƒ

15 Les caractères: conversions Fonction lenombre2 ( t: w ): entière Variablesz, k : entiers ; u : caractère convers: vecteur d entiers Corps k <-- 0 pour u de 0 à 9 faire convers u <-- k ; k <-- k + 1 fpour z <-- 0 pour k de 1 à N faire z <-- z * 10 + convers t k fpour lenombre2 <-- z Fin fonction 6_conversion_2 ƒ

16 Les chaînes de caractères Bloc lecture_fichier; Variables f, g : texte ; j, k : entiers nom_fichier_1, nom_fichier_2, nom_etudiant : chaîne Corps Lire ( nom_fichier_1 ) Ouvrir ( g, nom_fichier_1 ) Pour j de 1 à 2 faire lire ( nom_fichier_2 ) ouvrir ( f, nom_fichier_2 ) pour k de 1 à 10 faire lire ( f, nom_etudiant ); ecrire ( g, nom_etudiant ) fpour fermer_fichier ( f ) Fin pour Fin bloc 7_deux_fichiers ƒ

17 Les chaînes de caractères Bloc lecture_fichier2; Variablesnom_fichier, radical, nom_etudiant : chaîne f : texte ;j : caractère ; k : entier Corps Lire ( radical ) ; Pour j de 1 à 5 faire nom_fichier <-- radical // j ouvrir ( f, nom_fichier pour k de 1 à 6 faire lire ( f, nom_etudiant ); ecrire (k, nom_etudiant ) fpour fermer_fichier ( f ) Fin pour Fin bloc 8_concatenation ƒ

18 Les chaînes de caractères Bloc gestion_chaine; Variablesphrase : chaîne j : entier Corps Lire ( phrase ) ; Pour j de 1 à longueur ( phrase ) faire si phrase j faire écrire ( phrase j ) fin si Fin pour Fin bloc 9_gestion_chaine ƒ


Télécharger ppt "Algorithmique et programmation Informatique Cours 9 12/11/2001."

Présentations similaires


Annonces Google