La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

X Blast y pour tous. Recherche BLAST 1,2,3,4,5 1.Choisir sa séquence 2.Choisir le programme BLAST 3.Choisir la banque 4.Choisir les paramètres optionnels.

Présentations similaires


Présentation au sujet: "X Blast y pour tous. Recherche BLAST 1,2,3,4,5 1.Choisir sa séquence 2.Choisir le programme BLAST 3.Choisir la banque 4.Choisir les paramètres optionnels."— Transcription de la présentation:

1 x Blast y pour tous

2 Recherche BLAST 1,2,3,4,5 1.Choisir sa séquence 2.Choisir le programme BLAST 3.Choisir la banque 4.Choisir les paramètres optionnels 5. … et attendre un peu

3 GO Banque non redondante séquence Domaines conservés

4 Séquence AC, FASTA ou text

5

6 Choisir un programme BLAST

7 ProgrammeEntréeBanque 1 blastnDNA DNA 1 blastpprotéine protéines 6 blastxDNA protéines 6 tblastnprotéine DNA 36 tblastxDNA DNA

8 5 CAT CAA 5 ATC AAC 5 TCA ACT 5 GTG GGT 5 TGG GTA 5 GGG TAG … un ADN peut, potentiellement, coder 6 protéines 5 CATCAACTACAACTCCAAAGACACCCTTACACATCAACAAACCTACCCAC 3 3 GTAGTTGATGTTGAGGTTTCTGTGGGAATGTGTAGTTGTTTGGATGGGTG 5

9 Choix de la banque nr = non-redundant (most general database) dbest = database of expressed sequence tags dbsts = database of sequence tag sites gss = genomic survey sequences htgs = high throughput genomic sequence

10 OPTIONS Chercher des domaines conservés

11 OPTIONS Entrez! Filter Scoring matrix Word size Expect organisme

12 OPTIONS RBP4 vs RBP4 avec option FILTRE

13 Filtre ON

14 Filtre OFF

15 taxonomy database query program

16 taxonomy

17 Cut-off:.05? ?

18

19 Alignment view

20

21 MEUH !


Télécharger ppt "X Blast y pour tous. Recherche BLAST 1,2,3,4,5 1.Choisir sa séquence 2.Choisir le programme BLAST 3.Choisir la banque 4.Choisir les paramètres optionnels."

Présentations similaires


Annonces Google