La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Le pouvoir pathogène de la bactérie Bordetella bronchiseptica Bordetella beta- protéobactérie bronchiseptica Coccobacille gram négatif, mobile aérobie.

Présentations similaires


Présentation au sujet: "Le pouvoir pathogène de la bactérie Bordetella bronchiseptica Bordetella beta- protéobactérie bronchiseptica Coccobacille gram négatif, mobile aérobie."— Transcription de la présentation:

1

2 Le pouvoir pathogène de la bactérie Bordetella bronchiseptica Bordetella beta- protéobactérie bronchiseptica Coccobacille gram négatif, mobile aérobie S et N + tractus respiratoire présent chez de nombreux mammifères responsable de bronchopneumonie chez les animaux zoonose possible parent de B. pertussis et B. parapertussis génome séquencé (5.3Mbase) Bordetella ssp.facteurs de virulence (adhesines et toxine) exprimées sous le contrôle dun système à 2 composants (BvgAS system) nécessité dun TTSS pour induire la cytotoxicité, la colonisation à long terme de la trachée

3 Le pouvoir pathogène de la bactérie Bordetella bronchiseptica BvgAS système:BvgS: protéine membranaire histidine kinase senseur du milieu extracellulaire activée, phosphoryle BvgA BvgA: facteur de transcription pour les gènes de virulence régulation du TTSS Système de sécrétion de type 3 : très conservé chez les bactéries Gram- un des mécanismes très impliqué dans la virulence translocation des effecteurs du cytosol de la bactérie dans le cytoplasme de la cellule hôte selon le stade de linfection, les effecteurs peuvent variés

4 Représentation dun TTSS Protéines sécrétées via le TTSS : 4 protéines identifiées chez Bordetella. BopB, BopD, BopN et Bsp22 BopB/D complexe de perforation de la membrane plasmique BopN ATPase permettant la sécrétion Objetif de létude: Identifier de nouveaux effecteurs de Bordetella passant via le TTSS

5 Recherche de protéines sécrétées via le TTSS -Comparaison des profils protéiques des surnageants de culture des souches wt et ΔTTSS en SDS-PAGE 10 bandes différentes entre les 2 pistes dont BopB, BopN, BopD, Bsp 22 -Extraction du gel des 6 bandes non identifiées -Trypsination et analyse par spectromètre de masse pour identification des protéines MALDI-TOF MS ou ESI-MS/MS -génération in silico dune banque de peptides à partir du génome

6 Recherche de protéines sécrétées via le TTSS Une seule protéine a été identifié à lissue du screening. HP de 69 kDa renommée BopC -Analyse des séquences peptidiques: 3 bandes sont des produits de dégradation de Bsp22 et BopD Bande a 1 peptide résidus de HP p69 Bande b5 peptides

7 Les bandes a (150kD) et b (28kD) correspondent –elles à une seule protéine BopC? Génération dun mutant ΔBopC Clonage puis délétion du gène bopC via le système Gateway Introduction dans un plasmide suicide conjugatif (pRK6) Complémentation du mutant ΔBopC par le plasmide pBopC Clonage dune cassette promoteur fha- bopC- terminateur rrnB1 fha hémagglutinine filamenteuse de Bordetella activé par BvgA Introduction dans un plasmide réplicatif conjugatif (pRK415)

8 Les bandes a (150kD) et b (28kD) correspondent –elles à une seule protéine BopC? Comparaison des profils de sécrétion formation de complexe multimérique sécrétion dépendante dun TTSS

9 BopC a-t-elle un effet cytoyoxique? Recherche dun effet cytotoxique de BopC Infection de cellules L2 de rat pendant 20 min Coloration avec une solution de Giemsa (différenciation nucléaire et cytoplasmique) 95% des cellules infectées par les témoins + sont détruites Pas de cellules dégradées pour les mutants ΔbopC et ΔTTSS

10 Recherche dun effet cytotoxique de BopC Infection de cellules HeLa Evaluation de la cytotoxicité par mesure de la LDH La cytotoxité de B. brochiseptica est associée à bopC. BopC a-t-elle un effet cytoyoxique?

11 Recherche dun effet cytotoxique de BopC Infection de cellules HeLa pendant 1h Evaluation de la mortalité par coloration au bleu trypan 57%48% BopC a-t-elle un effet cytoyoxique?

12 Données bibliographiques B. brochiseptica induit une nécrose des cellules sans activation des caspases Cependant, observation de certaines cellules infectées TUNEL + (terminal deoxynucleotidyl transferase- mediated dUTP-biotin nick end-labelling) Coloration différentielle de la mort cellulaire: Cellules apoptotiques coloration dense au niveau du noyau Cellules non apoptotiques: coloration diffuse du noyau BopC a-t-elle un effet cytoyoxique?

13 Evaluation de la mort cellulaire Observation des cellules HeLa infectées à 2h (ou 5h pour la stauroporine) BopC est requis pour linduction de la mort cellulaire, mais ninduit pas dapoptose. BopC a-t-elle un effet cytoyoxique? Stsp: staurosporine, inhibiteur des PK

14 BopC est-elle une protéine formant un pore du TTSS? Mesure de lactivité hémolytique (30min de contact) Contrairement à BopB/D, BopC nappartient pas au complexe de perforation de la membrane plasmique BopC a-t-elle un effet cytoyoxique?

15 BopC et phosphorilation Données bibliographiques B. brochiseptica induit des déphosphorylations dans des cellules L2 infectées. Ce phénomène est TTSS dépendant. Recherche dun effet de BopC sur les protéines tyrosine phosphorylées (PY). Observation par immunofluorescence de différents facteurs: adhérence bactérienne ( actine et bactérie) Etat de phosphorylation des PY

16 BopC et phosphorilation Observation des cellules HeLA après 0, 20 min ou 1h dinfection

17 BopC et phosphorilation Au cours du développement de linfection: ladhésion et la colonisation des cellules ne sont pas modifiées chez les mutants ΔbopC et ΔTTSS. létat de phosphorylation des PY est modifié par la souche wt mais ni par le mutant ΔbopC, ni par le mutant ΔTTSS BopC induit une déphosphorylation des PY dans les cellules infectées.

18 BopC et phosphorilation Au cours du développement de linfection B. brochiseptica BopC : requis pour linduction de la mort cellulaire modifie létat de phosphorylation des PY Sur quel aspect BopC agit principalement? Infection de cellules HeLa en présence dinhibiteur de la déphosphorylation, le sodium orthovanadate Observation en microscopie à fluorescence Mesure de la cytotoxicité (LDH et TUNEL)

19 BopC et phosphorilation Infection de cellules HeLa par B. brochiseptica wt en présence ou non de vanadate + - Létat de déphosphorylation des PY dans les cellules en présence de vanadate est relativement atténué.

20 BopC et phosphorilation Infection de cellules HeLa par B. brochiseptica en présence ou non de vanadate Observation sur 200cellules au hasard La présence de vanadate atténue la déphosphorylation des PY induite par BopC.

21 BopC et phosphorilation Infection de cellules HeLa par B. brochiseptica en présence ou non de vanadate

22 BopC et phosphorilation Infection de cellules HeLa par B. brochiseptica en présence ou non de vanadate Le vanadate et donc létat de déphosphorylation des PY nont pas deffet sur la cytotoxité cellulaire. [PY] dans les cellules infectées par B. brochiseptica a lieu après la mort cellulaire dépendante de BopC.

23 BopC et sécrétion via le TTSS Données bibliographiques Les effecteurs TTSS dépendants sont introduits directement dans la cellule hôte depuis le cytoplasme bactérien via le TTSS. BopC est-elle un effecteur de type III? Utilisation dun système rapporteur TEM-1 β-lactamase ( Charpentier et Oswald, 2004) Fluorescence Resonance Energy Transfert

24 BopC et sécrétion via le TTSS Génération des fusions TEM1 Amplification PCR des gènes bopC, bcrH2 (protéine cytoplasmique induit par BvgA) et map (effecteur de EPEC) Clonage dans le pCX340 (fusion traductionnelle avec TEM1) puis PCR pour introduction dans un plasmide réplicatif conjugatif (pRK415) via le système Gateway,

25 BopC et sécrétion via le TTSS Analyse des transformants ΔbopC et ΔbopB et ΔTTSS avec les plasmides TEM1 Protéines totalesProtéines sécrétées 5% 20% Les produits de fusion BopC-TEM1 sont correctement synthétisés et sécrétés exceptés dans la souche ΔTTSS.

26 BopC et sécrétion via le TTSS BopC est transloquée via le TTSS dans la cellule hôte. Le signal dadressage se situe dans les 48 premiers acides aminés N-ter. Cellules HeLa infectées+ CCF2-AM 70% FRET+

27 BopC et cytotoxicité dans la cellule hôte BopC a un effet cytotoxique mais est-il direct ou résulte –t- il dune cascade de régulation? Clonage de BopC dans un plasmide dexpression eucaryote Transfection des cellules COS-7, HeLa, 293T Mesure de la cytotoxicité à 18h Lexpression de BopC directement dans la cellule permet dinduire la mort cellulaire sans intervention dautres facteurs de virulence.

28 Discussion BopC (Bordetella outer protein involved in cytotoxicity) protéine de 69kDa impliquée dans la mort cellulaire protéines sécrétées via le TTSS: pore forming proteins (translocators) (1) ou effecteurs (translocated protéins) (2) effecteur de cytotoxicité qui provoque la nécrose des cellules infectées. Analyse in silico du gène bopC BopC a une fonction protein-tyrosine phosphatase (PTPase) comme YopH mais rBopC activité PTPase – membre de la famille PTPase activité catalytique sur la cystéine 403 dans YopH BopC na pas de cystéine Leffet PTPase ne serait pas lié à BopC

29 Discussion Analyse in silico du gène bopC Recherche de protéines homologues et ou de motifs conservés Présent uniquement chez les souches de Bordetella (identité >95%) Localisation à lextérieur du locus TTSS idem pour dautres effecteurs de TTSS (SopE, SigD, orf3,Nle5) Recherche dîlots de pathogénie dans une région de 20kb flanquant bopC transposase 5kb en amont de bopC B.parapertussis transposase 2kb en amont et intégrase 1.6kb en aval de bopC B. pertussis Rien chez B. bronchiseptica Régulation + de bopC par le système BvgAS

30 Discussion La protéine BopC BopC est sécrétée sous forme de multimère ou compléxée ( kDa >69kDa) observation en SDS-PAGE de tels phénomènes pour des protéines ayant de nombreux segments TM mais BopC possède un seul TM prédit ( aa) la multimérisation de BopC serait porté par la partie Cter ( aa) de BopC BopC et TTSS Les TTSS peuvent sécréter des effecteurs hétérologues: Xanthomonas TTSS reconnaît YopE; Yersinia TTSS reconnaît Pseudomonas AvrB et AvrPto; Bordetella TTSS reconnaît EPEC Map bien que moins stable ( absence de la chaperone CesT) BopC aurait un effet régulateur sur lexpression des autres protéines du TTSS

31

32 La spectrophotométrie de masse MALDI-TOFMatrix –assisted laser desorption/ionization Time of Fly ESI Electrospray Ionization

33 Phage lambda recombination in E. coli The Gateway® System relies on five sets of specific and non cross- reacting att sequences The specificity is given by the 7 nucleotides of the core region Phage attP cos 232 bp attB E. coli x 21 bp attL Lysogen attR 96 bp157 bp Integration (Int, IHF) Excision (Int, IHF, Xis)

34 Glossary of terms used in Gateway® cloning att site – A defined length of DNA that constitutes a recombination site. There are 4 classes of att sites called attB, attP, attL, and attR. ccdB gene – A counterselectable gene that allows for negative selection of unwanted by- product plasmids after recombination. Donor (pDONR) Vector – A vector with attP sites flanking a counterselectable gene that recombines with a gene of interest flanked by attB sites. BP reaction – A recombination event between attB and attP sites catalyzed by BP Clonase II Entry (pENTR) clone – A vector that contains your gene of interest flanked by attL or attR sites. LR reaction – A recombination event between attL and attR sites catalyzed by LR Clonase II Destination (DEST) Vector – An application-geared vector with attR sites flanking a counterselectable gene that will recombine with one or more entry clones. MultiSite Gateway® Technology – A system that allows simultaneous assembly of multiple DNA fragments into a single destination vector

35 90-99% correct clones on Kan plates Building a Gateway® Entry Clone ++ BP Clonase II Obtaining a Gateway® Expression Clone 90-99% correct clones on Amp plates ++ LR Clonase II

36 CTGCTTTTTTGTACAAACTTG attB1 CAGCTTTCTTGTACAAAGTTG attB2 CAACTTTATTATACAAAGTTG attB3 CAACTTTTCTATACAAAGTTG attB4 CAACTTTTGTATACAAAGTTG attB5 Standard Gateway® MultiSite Gateway®

37 Invitrogen Proprietary & Confidential XXXX X X attB2attB5 attP2attP5 attR2attR1 attB5rattB1 attP5rattP1 attL5 attL1 attB2attB5attB1 attL2 attR5 PCR Fragments pDONRs Entry Clones Destination Vectors Expression clones 2-fragment MultiSite Gateway® Pro BP reactions LR reaction

38 Invitrogen Proprietary & Confidential MultiSite Gateway® Three-Fragment Vector Construction Kit Cm R XX Entry clones Destination vector attB3attB4attB2attB1 Expression clone attR1attL4attL3attR2 attR3attR4 attL2attL1 ccdB XXXX attB1rattB4 attP1rattP4 attB2attB1 attP2attP1 attB3attB2r attP3attP2r XX PCR Fragments pDONRs BP reactions LR reaction

39 Système TEM


Télécharger ppt "Le pouvoir pathogène de la bactérie Bordetella bronchiseptica Bordetella beta- protéobactérie bronchiseptica Coccobacille gram négatif, mobile aérobie."

Présentations similaires


Annonces Google