La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Activateur = ??? Exemple dun activateur transcriptionnel La protéine CRP.

Présentations similaires


Présentation au sujet: "Activateur = ??? Exemple dun activateur transcriptionnel La protéine CRP."— Transcription de la présentation:

1 Activateur = ??? Exemple dun activateur transcriptionnel La protéine CRP

2 Classe I Changement de conformation Busby and Savery ENCYCLOPEDIA OF LIFE SCIENCES & 2007, John Wiley & Sons, Ltd. p1-9www.els.net Classe II Taux de transcription CRP Mécanismes simples

3 La protéine CRP cAMP receptor protein = CAP (catabolite gene activating protein) AMPc CRP + Nbrx promoteurs incluant Plac, Pgal, Para, Pmal Chez E. coli CRP Certains promoteurs/Pcrp, Pcya 209aa ADN N N HTH C AMPc

4 Les promoteurs cibles AAATGTGATCTAGATCACATTT 22pb Angle ~ 90 o Interactions ARNpol

5 Classe I AR1 ADN N N HTH C Busby and Savery ENCYCLOPEDIA OF LIFE SCIENCES & 2007, John Wiley & Sons, Ltd. p1-9www.els.net Plac -61,5 AR1 aval Affinité ADN Liaison coopérative sur ADN AR2 AR3

6 Classe II ADN N N HTH C Busby and Savery ENCYCLOPEDIA OF LIFE SCIENCES & 2007, John Wiley & Sons, Ltd. p1-9www.els.net AR1 AR2 AR3 Pgal -41,5 1)Fixation AR1 amont CTD effet inhibiteur : neutralisation CTD AR1non nécessité) Quelle(s) manips: Hyp CTD mal positionnné, CRP corrige????? 2) Activation AR2 aval 3 aa+ NTD 4 aa - Facilite isomérisation AR3 aval Stabilisation ARNpol et facilite isomérisation

7 Classe III classe I + classe II 2 classe I Plusieurs sites Synergie des CRPActivation -61,5 -91,5 -41,5-91,5 Daprès Busby and Savery ENCYCLOPEDIA OF LIFE SCIENCES & 2007, John Wiley & Sons, Ltd. p1-9www.els.net

8 Répression par CRP CRP Certains promoteurs/Pcrp, Pcya CRP -Autorégulation ARNpol crp -deoP Métabolisme des pyrimidines +cytidine CRP activateur -cytidine CRP permet fixation du répresseur CytR

9 Répression catabolique; Carbon catabolite repression=CCR J. Monod: croissance dE. coli + mélange sucres??? Ce phénomène a été appelé ??? -Niveau AMPc régulé par système de transport des sucres: PTS, qui contrôle activité AC PTS= sugar Phosphotransferase system -Ce système nécessite EI et HPr protéines générales EII sucre-spécifiques: 3 à 4 domaines IIA et IIB Autres domaines P transfert Passage membrane P transfert PEPsucre P Mb Chez E. coli

10 GlpK=Glycérol Kinase LacY=lactose perméase AC=adénylate cyclase CM=cell membrane PEP=phosphoénol pyruvate Le système PTS CRP activation Opérons cataboliques LacY GlpK AC -Glu Inducteur exclusion Daprès Stülke et Hillen Current opinion in Microbiology 1999 vol 2 p 195_201

11 Rappels: Régulation opéron lactose lacZ lacYlacA lacI En présence ou absence de quel(s) sucre(s)???? 1)+Glu ou +Lac ou +Glu+Lac AMPcidem +Lac -Glu Allolac + inactif AMPc CRP active CRP* active +Glu+Lac pas expression 2) Qui de CRP-AMPc ou exclusion de linducteur est le principal responsable du phénotype Glu répression???

12 CCR chez B. subtilis et bactéries apparentées (G+, low GC) PEPsucre P Mb Le composant central du PTSHPr -2 sites de phosphorylation EI (His-15) Hpr kinase (Ser-46) PtsK Régulation Importance de Phosphorylation de Hpr dans CCR

13 Reg spé= Régulateurs spécifiques contenant un PTS reg domain=PRD Exp: levR (levanase), licT ( -glucoside) GlpKReg spé -Glu +Glu PTS chez B. subtilis 1 2 Daprès Stülke et Hillen Current opinion in Microbiology 1999 vol 2 p 195_201 Induc gly meta Glycérol-3-P

14 -CcpA Répresseur de la famille LacI -Promoteurs cibles Le répresseur CcpA Séquence cre : catabolite responsive element Localisation: -dans promoteur(exp amyE) -dans seq codante (exp xyl) -en amont des promoteurs (exp lev) CCR médiée par CcpA Expériences?????? -Interaction spécifique CcpA/Hpr-S46-P Fixation sur cre -Crh = Hpr-like proteineCrh-Ser46 par PtsK mais 0 P par EI Complexe ternaire CcpA 2 / 2Hpr-S46-P /cre

15 GlpKReg spé -Glu +Glu Conclusions 1 CRP activation Opérons cataboliques LacY GlpK AC -Glu Inducteur exclusion E. coli B. subtilis Deux mécanismes différents pour CCR enteric bactéries/G+low G+C Repression des opérons cataboliques Gènes codant Hpr et Hpr kinase chez G- non enteriques CCR? Dans tous les cas Rôle important de la P dans régulation au sens large -Glu

16 Conclusions 2 Régulation transcriptionnelle avec comme point de départ CRP -Protéine: fonction et structure -Interaction avec autres macromolécules -Etude des cibles -Physiologie Quelles techniques????


Télécharger ppt "Activateur = ??? Exemple dun activateur transcriptionnel La protéine CRP."

Présentations similaires


Annonces Google