La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Bi 231: Ingénierie des Protéines cours 4. Plan Général I. Introduction et rappels. II. Purification des protéines. III. Surexpression d'une protéine.

Présentations similaires

Présentation au sujet: "Bi 231: Ingénierie des Protéines cours 4. Plan Général I. Introduction et rappels. II. Purification des protéines. III. Surexpression d'une protéine."— Transcription de la présentation:

1 Bi 231: Ingénierie des Protéines cours 4

2 Plan Général I. Introduction et rappels. II. Purification des protéines. III. Surexpression d'une protéine. IV. Mutagenèse: techniques et applications. V. L'insuline : exemple d'une stratégie. VI. Analyse d'articles.

3 IV. Mutagenèse: techniques et applications. 41.Mutagenèse aléatoire. 42.Alanine scanning. 43.Mutagenèse dirigée

4 41 Mutagenèse aléatoire. Objectifs : modification du phénotype, recherche de la mutation associée Moyens : irradiations (UV, RX), produits chimiques utilisation de DNApol modifiée

5 Agents mutagènes Irradiations modification d'une ou plusieurs bases produits chimiques : DNApol modifiée, suppression de la fonction exonucléasique pas de correction possible (exple fragment kleenow, MutaGen )

6 Objectifs : recherche du (des) résidu(s) responsable(s) de la fonction d'une protéine. Moyens : amplification par PCR du gène de la protéine d'intérêt avec oligonucléotides adaptés. 42 Alanine scanning.

7 Principe de la PCR.

8 Séquence nucléique actgtggttcttcggccatcccgaggtctatatcatcatcctgccgggcttcggcatcatca ------------cttcggccatcccgaggtgcttatcatcatcctgccgg------------------------ Séquence protéique T V V L R P S R G L Y H H P A G L R H H - - - - - - R P S R G A Y H H P A G L R H H

9 Objectifs : Modification ciblée d'un résidu pour étudier sa fonction dans une protéine. Moyens : amplification par PCR du gène de la protéine d'intérêt avec oligonucléotides adaptés. 43 mutagenèse dirigée

10 Séquence nucléique actgtggttcttcggccatcccgaggtctatatcatcatcctgccgggcttcggcatcatca ------------cttcggccatcccgagacctatatcatcatcctgc------------------------ Séquence protéique T V V L R P S R G L Y H H P A G L R H H - - - - -L R P S R D L Y H H P

Télécharger ppt "Bi 231: Ingénierie des Protéines cours 4. Plan Général I. Introduction et rappels. II. Purification des protéines. III. Surexpression d'une protéine."

Présentations similaires

Annonces Google