La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

LA THÉORIE DE L’ÉVOLUTION. Facteurs de l’évolution Selection naturelle 1 Mutation fortuite 2,3 Dérive gènètique 4 1 Darwin, 1856; 2 Muller, 1926; 3 Luria,

Présentations similaires

Présentation au sujet: "LA THÉORIE DE L’ÉVOLUTION. Facteurs de l’évolution Selection naturelle 1 Mutation fortuite 2,3 Dérive gènètique 4 1 Darwin, 1856; 2 Muller, 1926; 3 Luria,"— Transcription de la présentation:


2 Facteurs de l’évolution Selection naturelle 1 Mutation fortuite 2,3 Dérive gènètique 4 1 Darwin, 1856; 2 Muller, 1926; 3 Luria, 1943; 4 Wright, 1945; 5 Monod, 1969 “L’hasard et la nècessitè” 5

3 1. HISTORIQUE Révolution: Philosophique Théologique Scientifique 24 novembre 1859 : Charles Darwin « L’origine des espèces par sélection naturelle »

4 Les espèces se transforment au cours du temps, elles évoluent. Il y a donc une « histoire » de la vie. Darwin propose une théorie pour expliquer ces transformations: Théorie de l’évolution par sélection naturelle. La théorie de Darwin forme un tout cohérent et s’appuie sur l’ensemble des connaissances de l’époque en géologie et en biologie. La théorie sera rapidement acceptée par l’ensemble des biologistes. Selon la théorie de l’évolution:

5 2 Le lamarckisme Jean-Baptiste Monet, Chevalier de Lamarck (1744-1829) 1809 : « Philosophie zoologique » Les espèces se transforment en se complexifiant continuellement (forment des lignées visibles dans les fossiles) Des organismes simples se forment sans arrêt par génération spontanée

6 Évolution selon Lamarck: 1. Loi de l’usage et du non usage Usage d ’un organe  développement de l ’organe Non usage  atrophie 2. Hérédité des caractères acquis Caractéristiques acquises par l ’usage (ou perdues par le non usage) se transmettent aux déscendants ==> transformations lentes et progressives au cours du temps

7 Évolution de la girafe selon Lamarck Ancêtre à cou court mange les feuilles des arbres. Fait des efforts pour atteindre les feuilles les plus hautes L’animal s’étire le cou et les pattes. Ces organes s’allongent L’allongement se transmet de façon imperceptible aux descendants.

8 Théorie de Lamarck rejetée: De plus important, on va démontrer par la suite : Pas de transmission des caractères acquis De son vivant: L’idée d ’évolution est encore trop nouvelle. Forte opposition religieuse et scientifique.

9 3. Le darwinisme Charles Darwin (1809 - 1882) Études en médecine (qu ’il abandonne) puis en théologie et sciences naturelles. À 22 ans (1831) s ’embarque sur le HMS Beagle. Charles Darwin (1840) HMS Beagle

10 Voyage de 5 ans autour du monde: but = cartographier certaines régions peu connues. Au cours du voyage Darwin élabore sa théorie et recueille de nombreuses données pour l’étayer.

11 Au cours du voyage du Beagle Darwin observe : Espèces de régions différentes d ’Amérique du Sud se ressemblent souvent entre elles. Espèces retrouvées dans un milieu particulier d’Amérique du Sud ressemblent plus aux espèces d’autres régions d’Amérique du Sud qu’aux espèces trouvées dans des milieux similaires sur d’autres continents. Fossiles d’Amérique du Sud ressemblent aux espèces actuelles d’Amérique du Sud. Îles possèdent des espèces uniques qui ressemblent à d’autres espèces du continent le plus proche. Ex. Îles Galápagos (900 Km à l ’Ouest de l’Amérique du Sud)

12 giant ground sloth (fossile) et bradipus (vivent) Gliptodonte Armadillo Ancestor of hard shelled mammals Ancetre commun temps

13 Gliptodonte Armadille Ancestor of hard shelled mammals Ancetre commun temps

14 Feuilles Insects Graines dursCactus Les différentes espèces de pinsons de Galapagos ont de becs très différents selon leur spécialisations alimentaires

15 Déscendence avec modification

16 Retour du voyage : 1836 Ne publie pas sa théorie, se contente d’en noter les grandes lignes. 1858 : lettre de Alfred Russel Wallace. Expose la même théorie Le mois suivant : publication officielle de la théorie (cosignée Darwin-Wallace). 1859 : Publication de « L’origine des espèces par sélection naturelle ». Succès instantané de librairie. 10 ans plus tard, la théorie de Darwin est acceptée par la grande majorité des biologistes. Alfred Russel Wallace

17 Théorie de Darwin 1. Sans limitation, une population s’accroît de façon exponentielle Une morue peut pondre plus de 6 millions d’œufs. Si chacun de leurs descendants survivaient un seul couple d’éléphants pourrait engendrer 19 millions d’éléphants en 750 ans.

18 Théorie de Darwin 1. Sans limitation, une population s’accroît de façon exponentielle 2. Années après années, les populations demeurent relativement stables. Des facteurs limitants empêchent l’accroissement exponentiel. La population humaine augmente plus vite que la production des ressources alimentaires. Darwin s’était inspiré pour ce point d ’un ouvrage de l’économiste Thomas Malthus (1766- 1834): Thomas Malthus

19 Théorie de Darwin 1. Sans limitation, une population s’accroît de façon exponentielle 2. Années après années, les populations demeurent relativement stables Des facteurs limitants empêchent l’accroissement exponentiel. 3. Il y a des variations entre les individus: à chaque génération, les descendants diffèrent de leurs parents et diffèrent entre eux.

20 Théorie de Darwin 1. Sans limitation, une population s’accroît de façon exponentielle 2. Années après années, les populations demeurent relativement stables Des facteurs limitants empêchent l’accroissement exponentiel. 3. Il y a des variations entre les individus: à chaque génération, les descendants diffèrent de leurs parents et diffèrent entre eux. 4. Si une différence s’avère avantageuse face à l’environnement de l’organisme, le ou les individus qui la possèdent ont plus de chances de survivre que ceux de la population qui ne la possèdent pas. Et donc plus de chances de se reproduire et de transmettre leur caractéristique = SÉLECTION NATURELLE

21 Théorie de Darwin 1. Sans limitation, une population s’accroît de façon exponentielle 2. Années après années, les populations demeurent relativement stables Des facteurs limitants empêchent l’accroissement exponentiel. 3. Il y a des variations entre les individus: à chaque génération, les descendants diffèrent de leurs parents et diffèrent entre eux. 4. Si une différence s’avère avantageuse face à l’environnement de l’organisme, le ou les individus qui la possèdent ont plus de chances de survivre que ceux de la population qui ne la possèdent pas. Et donc plus de chances de se reproduire et de transmettre leur caractéristique = SÉLECTION NATURELLE 5. Le caractère avantageux a donc tendance à se répandre jusqu’à ce que ceux qui le possèdent surpassent et remplacent ceux qui ne l’ont pas.

22 La phalène du bouleau (Biston betularia) Jusqu ’en 1848 (Angleterre), tous les spécimens connus = forme pâle À la fin du XIX e siècle, 98% des individus = forme mélanique Forme pâleForme mélanique

23 La phalène du bouleau (Biston betularia) Forme pâle = bon camouflage sur les troncs d’arbres couverts de lichen. Forme mélanique = bon camouflage sur les troncs dépourvus de lichens et noircis par la pollution. À partir du milieu du XIX e siècle, la pollution a fait disparaître les lichens des arbres et la suie les a noircis. Dans les régions polluées, la sélection naturelle a remplacé les pâles par la forme mélanique en quelques années. Dans les régions où on a mis fin à la pollution, les pâles sont redevenus majoritaires.


25 La forme pâle et la forme mélanique dependent de un gènè qui peut etre en deux formes alternatives (alleles). L’effet de la Selection Naturelle est de fair changer les frequences relatives de les deux alleles, Pollution + Predateurs

26 Par quel mechanisme les phalènes melaniques sont devenues majoritaires? ? QUESTION ?

27 Y a-t-il évolution actuellement dans l’espèce humaine? Pour qu’il y ait évolution, il faut : Diversité génétique Sélection naturelle Est-ce le cas chez les humains ?

28 La théorie darwinienne de l’évolution n’est pas complète: Lois de la génétique ne sont pas connues. On ne sait rien de l’information génétique. Darwin ne peut expliquer d’où proviennent les nouveaux caractères qui seront sélectionnés. Les découvertes en génétique au cours du XXe siècle permettent de compléter la théorie

29 Théorie synthétique de l’évolution ou Néo-darwinisme Théorie synthétique de l’évolution ou Néo-darwinisme


31 En semant 100 millions de bactéries sur des boites qui contiennent un exces de virus qui tuent les bactéries, on retrouvent environ 10 colonies* par boite, c'est-à-dire que seulement 1 bactérie sur 10 millions donne lieu à une colonie Théorie adaptative (ou inductive) = la mutation est induite parmi contact par l’agent antibactérien avec une probabilité de un sur 10 millions. Théorie sélective (ou pré-adaptative) = la mutation se déroule par hasard et pré-existe au contact avec l’agent antibactérien. Un sur 10 millions est la fréquence des mutants, pas celle de la mutation. *Colonie=déscendence de une seule bacterie

32 Donc…. Théorie sélective contre Théorie adaptative! A noveau, c’est Darwin contre Lamarck!

33 L’intuition pour résoudre le dilemme vint à Luria en observant des collègues qui jouaient à la slot- machine. Il remarqua que la machine d'habitude ne donnait pas de pièces, mais quand elle en donnait, elles pouvaient être 1, 2, 4, … 256, bref des “familles” plus ou moins grandes de pièces. Il raisonna que la mutation aussi pouvait engendrer des “familles” plus ou moins grandes de mutants selon quand elle était arrivé dans la croissance des bactéries avant l’exposition au virus.

34 m m m Théorie sélective les mutations sont clonales Fluctuation haute virus Considérons les trois dernières divisions bactériennes avant l'exposition au virus

35 Culture diluée (5x10 3 bactéries/ml) Croissance à 37°C jusqu'à 5x10 8 bactéries/ml L’expériment de Luria (1943)

36 Culture diluée (5x10 3 bactéries/ml) Croissance à 37°C jusqu'à 5x10 8 bactéries/ml Il sème 0.2 ml (1x10 8 )bactéries sur des boites contenantes virus

37 Culture diluée (5x10 3 bactéries/ml) Croissance à 37°C jusqu'à 5x10 8 bactéries/ml Mutants virus-resistents depuis 10 cultures indépendentes Mutants virus-resistents depuis 10 répliques de la même culture EFFET SLOT- MACHINE !!

38 Mutants Ton R depuis 10 cultures indépendentes 1, 3, 0, 0, 12, 4, 137, 0, 0, 53 Tot= 210; F mutants = 2.1x10 -7 m= 21; s= 43.9 Fluctuation = s/m = 2.09 Mutants Ton R depuis 10 répliques de la même culture 22, 15, 17, 24, 33, 14, 26, 26, 20, 15 Tot= 212; F mutants = 2.1x10 -7 m= 21.2; s= 6.2 Fluctuation = s/m = 0.29 Selon la théorie adaptative, Fluct répliques = Fluct cult. indép., tandis que 2.09 0.29

39 m m m Théorie sélective les mutations sont clonales Fluctuation haute Virus mm m Théorie adaptative les mutations sont toutes indépendentes Fluctuation basse Virus

40 Donc, l’apparition de la mutation est fortuite et indépendante de la sélection (pendant l'expériment, elle précède même la sélection). Quand elle intervient, la sélection altère la fréquence des mutants dans la population (pendant l’expériment, elle élimine même toutes les bactéries non mutées). La sélection naturelle imposée par le virus a changé la frequence de mutants virus-resistents de 1/10 7 a 100%. En d’autres cas, la sélection est moins severe, par example elle change une fréquence génique du 10% au 20%, ou du 0.1% au 10%.

41 Une partie dans l'’humain (foie et globules rouges) Une partie du cycle reproducteur dans le moustique Si les globules rouges sont malades, comme dans l'anémie falciforme ou dans la thalassémie, les parasites ne se reproduisent pas bien et causent une forme de malaria moins grave (non mortelle). Paludisme (Plasmodium Sp.)

42 La malaria est un facteur sélectif très puissant. Dans les zones malariques, les gènes qui causent des défauts dans les globules rouges sont beaucoup plus fréquents que dans le reste du monde ANEMIE FALCIFORME THALASSEMIA MAJOR

43 L’anémie falciforme, comme la thalassémie, est une maladie mortelle, la plus part des malades (SS) meurt d'anémie sans laisser de fils. Les “porteurs” d'une seule copie du gène qui cause la maladie (AS) sont pratiquement sains et survivent à la malaria mieux des normaux (AA). PALUDISMEANEMIE Donc, la fréquence du gène S dans la population augmente jusque quand le paludisme persiste. Après la bonification, la fréquence du gène diminue. Par example, les noirs américains ont une fréquence du gène S mineure du 5%, même s'ils proviennent des régions de l’Afrique où la fréquence est supérieure au 20%

44 Cette situation s'appelle “polymorphisme balancé”, ou “avantage de l’hétérozygote”. Elle s'applique à beaucoup de gènes-maladies, en fait à toutes celles pour lesquelles la fréquence génique est plus haute de la fréquence de mutation (encore, l’effet slot- machine!). Ceux pour lesquels on a proposé un mécanisme sont, chez l'homme, la mucoviscidose (résistance à la perte des liquides) et la maladie de Tay-Sachs (résistance à la tubercolose)

45 Cheetah Juifs Askenazi Dérive gènètique aleatoire Population limité, petit nombre d’enfants, risque de perte ou de fixation de un allèle

46 AA Aa aa AA Aa AA (A)=80% (a)=20%

47 AAAa aa Naufrage! Un groupe fortuit survie et se reproduit sur une ile aa AA Aa AA aa (A) = 50% (a) = 50% 100 ans après EFFET FONDATEUR

48 L’effet fondateur est probablement responsible de l’absence quasi total du groupe sanguin B chez les Indiens d’Amérique (migré en très petit nombre à travers le détroit de Béring, il y a 20,000 ans) f(I B )

49 Facteurs de l’évolution Selection naturelle 1 Mutation fortuite 2,3 Dérive gènètique 4 1 Darwin, 1856; 2 Muller, 1926; 3 Luria, 1943; 4 Wright, 1945; 5 Monod, 1969 “L’hasard et la nècessitè” 5

50 5. Théorie synthétique de l’évolution Mutations génétiques font apparaître de nouvelles caractéristiques physiques. Exemples: Mutation d’un gène codant pour une enzyme : permet la formation d ’un nouvel allèle codant pour une enzyme possédant des propriétés différentes de l’ancienne. Mutation d’un gène intervenant dans le développement embryonnaire (homéogène) permet de grandes modifications physiques. Polygénie (multiplication des gènes dans le génome) permet la formation de nouveaux gènes qui s’ajoutent aux anciens.

51 Ex. évolution du lysozyme en alpha-lactalbumine Lys. Homme – Lys. Souris : 28 différences Lys. Homme - Lys. Poulet : 51 différences Lys. Homme - Lactalbumine : 76 différences Lys. Poulet - lactalbumine : 75 différences Le lysozyme varie d’une espèce à l’autre. Cette enzyme est présente chez tous les vertébrés. L’alpha-lactalbumine, une enzyme apparue avec les mammifères (sert à synthétiser du lactose dans le lait) ressemble beaucoup au lysozyme.


53 Ex. Évolution de la résistance aux organo-phosphorés chez le moustique Culex pipiensÉvolution de la résistance aux organo-phosphorés chez le moustique Culex pipiens L’AChE (acétylcholinestérase) mutée a peu d’affinité avec l’insecticide tout en conservant son affinité avec l’acétylcholine. L’AChE mutée est par contre moins efficace (sur l’A. choline) que la forme normale  la forme mutante est nuisible s’il n’y a pas d’insecticide dans l’environnement (c’est ce qu’on appelle le coût de la résistance) et avantageuse s’il y en a. On ne retrouve les moustiques mutés que dans les zones d’épandage. Culex pipiens peut être porteur du virus du Nil

54 Certains individus possédant deux copies du gène de l’enzyme (suite à une duplication du gène) ont acquis une version mutée du gène (gène ace-1). Ils possèdent donc une version normale (efficace pour dégrader l’A. choline) et une version mutée (résistante à l’insecticide). Ils sont donc avantagés que l’insecticide soit présent ou pas. Ces moustiques se sont rapidement propagés dans les zones où on utilise des insecticides. Le gène muté (ace-1) diffère du gène normal par un nucléotide. Le changement provoque la substitution d’un acide aminé du site actif par un autre acide aminé.

55 On connaît d’autres gènes responsables de la résistance. Ces gènes codent pour des enzymes (des estérases) qui dégradent l’insecticide avant qu’il ne puisse parvenir à la synapse. Il y a deux sortes d’estérases (les A et les B). On ignore actuellement à quoi servent ces estérases dans le moustique. Le gène seul est peu efficace. On a vu apparaître des formes mutantes résistantes chez qui le gène était amplifié (augmentation de l’expression suite à des modifications d’un gène régulateur ou multiplication en plusieurs copies) ce qui en augmente l’expression et donc l’efficacité. Ces moustiques se sont propagés dans les zones d’épandage des organo-phosphorés.

56 6. LA SPÉCIATION ET LE CONCEPT D'ESPÈCE Spéciation = formation d'une nouvelle espèce à partir d'une espèce ancestrale Mode le plus fréquent = cladogenèse ==> Diversité biologique

57 Il peut y avoir spéciation s'il y a isolement génétique : barrière qui empêche un groupe d'individus de se reproduire avec le reste de la population. Le groupe isolé peut diverger génétiquement au point de ne plus pouvoir se reproduire avec le reste de la population = nouvelle espèce.

58 Isolement peut être causé par: Barrières géographiques Formation d'îles Chaîne de montagne Glacier Désert Lacs isolés Etc.

59 Barrières biologiques Isolement écologique :une partie d'une population préfère un milieu écologique différent de celui du reste de la population. Isolement temporel Isolement éthologique (comportements différents) Isolement mécanique (appareils reproducteurs différents) Isolement gamétique (gamètes ne se reconnaissent plus suite à des mutations de protéines de surface) Isolement génétique (mutation qui rend certains individus stériles avec d'autres, mais fertiles entre eux)

60 Spéciation allopatrique Groupes séparés par un isolement géographique Spéciation sympatrique Les nouvelles espèces se forment sur le même territoire que l'espèce ancestrale (pas d'isolement physique)

61 The allopatric populations could be called subspecies or races if that is useful Deux populations de la meme èspece devient allopatriques Pas de croisements fertiles. Deux èspeces ont été généré Barrière geographique Croisements possibles. Meme èspece

62 Gradualisme et théorie des équilibres ponctués D'après les fossiles, c'est le mode équilibre ponctué qui serait le plus fréquent.

63 7. Les signes (preuves?) de l'évolution La sélection artificielle Les archives géologiques L'anatomie comparée L'embryologie La biogéographie La biologie moléculaire

64 La sélection artificielle

65 Les archives géologiques Permettent de se représenter la flore et la faune de différentes époques. Permettent de découvrir les transitions entre une forme ancienne et une forme plus moderne.

66 Évolution du cheval, caractérisée par: Accroissement de la taille. Réduction du nombre de doigts. Modification des dents N.B. L'évolution n'est pas graduelle ni linéaire (ça ressemble à un buisson).

67 Certains fossiles permettent d'imaginer comment s'est faite la transition entre de grands groupes. Ex. Fossile de l'Archaeoptéryx (transition entre reptiles et oiseaux, 150 MA).

68 L'anatomie comparée Ressemblances entre animaux même s'ils vivent dans des milieux très différents (ex. dauphin ressemble plus à un mammifère terrestre qu'à un poisson). Structures homologues = structures qui ont la même origine évolutive. Organes vestigiaux : organes devenus inutiles ou peu utiles, mais qui sont encore présents

69 Structures homologues : Membres avant des vertébrés Évolution des pattes

70 Convergence évolutive

71 Structures vestigiales: Bassin et membres arrières atrophiés chez la baleine ou chez certains serpents primitifs (boa).

72 Appendice chez humain (reste du caecum) Muscles des oreilles chez l'humain. Mécanisme de la "chaire de poule" Repli semi-lunaire de l'œil (reste d'une troisième paupière chez les reptiles). Animaux cavernicoles aux yeux atrophiés ou non fonctionnels Autres structures vestigiales

73 L'embryologie Les organismes qui ont une même origine évolutive présentent des développements embryonnaires semblables. Dents et fourrure au stade embryonnaire chez les baleines à fanons. Activation de certains gènes inactifs chez le poussin ==> formation de dents. Fentes branchiales chez les vertébrés. Queue au stade embryonnaire chez l'homme.

74 Poisson Oiseau Porc Homme

75 La biogéographie = étude de la distribution des espèces Îles abritent des espèces endémiques (uniques) apparentées à des espèces du continent le plus proche ou d'une île voisine. Îles Hawaii : ~ 250 espèces d'insectes ont envahi les îles après leur formation. Ces insectes ont évolué pour donner plus de 3000 espèces uniques aux îles. Des 1700 espèces végétales, 1430 sont endémiques. Dinosaures d'Afrique et d'Amérique du Sud : même espèces AVANT la formation de l'Atlantique. Espèces différentes après

76 Preuves moléculaires de l'évolution (descendence avec modification)

77 L'horloge moléculaire Différence génétique entre deux espèces provenant d'une même espèce ancestrale au temps écoulé depuis leur séparation évolutive est proportionnelle

78 Comparaison de séquences d'ADN. Comparaison de séquences d'acides aminés. Ex. Comparaison de la séquence en acides aminés des deux chaînes de l'hémoglobine Homme - chimpanzé : 0 AA de différence Homme - Gorille : 1 AA Gorille - Singe Rhésus : 6 AA Homme - Porc : 20 AA

79 10203040 M V H L T P E E K S A V T A L W G K V N V D E V G G E A L G R L L V V Y P W T QBG-human -........ N... T..........................BG-macaque - - M.. A... A.... F.... K....................BG-bovine -... S G G...... N...... I N. L................BG-platypus... W. A... Q L I. G....... A. C. A... A... I......BG-chicken -.. W S E V. L H E I. T T. K S I D K H S L. A K.. A. M F I..... TBG-shark 50607080 R F F E S F G D L S T P D A V M G N P K V K A H G K K V L G A F S D G L A H L DBG-human.......... S......................... N...BG-macaque........... A.... N............ D S.. N. M K...BG-bovine.... A..... S A G............ A... T S. G. A. K N..BG-platypus... A... N.. S. T. I L... M. R....... T S. G. A V K N..BG-chicken. Y. G N L K E F T A C S Y G - - - - -.. E. A... T.. L G V A V T.. GBG-shark 90 100110120 N L K G T F A T L S E L H C D K L H V D P E N F R L L G N V L V C V L A H H F GBG-human....... Q................ K...............BG-macaque D...... A................ K....... V... R N..BG-bovine D...... K................ N R..... I V... R.. SBG-platypus. I. N.. S Q.................... D I. I I... A.. SBG-chicken D V. S Q. T D.. K K. A E E.... V. S. K.. A K C F. V E. G I L L KBG-shark 130140 K E F T P P V Q A A Y Q K V V A G V A N A L A H K Y HBG-human..... Q.....................BG-macaque..... V L.. D F............. R..BG-bovine. D. S. E.... W.. L. S... H.. G....BG-platypus. D... E C... W.. L. R V.. H... R...BG-chicken D K. A. Q T.. I W E. Y F G V. V D. I S K E..BG-shark. Egale à la séquence di référence - Délétion Différences aminoacidiques dans les séquences de l’hémoglobine (chaîne beta)

80 BG-bovin BG-humainBG-macaque BG-platypus BG-poule BG-requin Arbre phylogénétique sur la base de la beta globine (BG)

81 No. de Aminoacides différents (par rapport à la Hb humaine) précurseur commun

82 Arbre phylogénétique tracé par l'étude comparative du cytochrome C

83 Evolution of the globins Hemoglobin Fibrinopeptides 1.1 MY 5.8 MY Cytochrome c 20.0 MY Separation of ancestors of plants and animals 1 2 3 4 6 7 8 9 10 5 Mammals Birds/Reptiles Reptiles/Fish Carp/Lamprey Mammals/ Reptiles V ertebrates/ Insects a 220 200 180 160 140 120 100 80 60 40 20 0 200100300400500600700800 Millions of years since divergence After Dickerson (1971) Corrected amino acid changes per 100 residues 90010001100120013001400 bcdefhi gj Huronian Algonkian Cambrian Ordovician Silurian Devonian Permian T riassic Jurassic Cretaceous Paleocene Oligocene Miocene Pliocene Eocene Carboniferous k varie selon les portions d'ADN considérées: S'il s'agit d'un gène vital : k est faible (la moindre modification risque d'être nuisible). S'il s'agit d'ADN non codant : k est élevé Nombre de différences entre deux protéines ou deux gènes = k t

84 TGGACAATGGACTATCGACATTCGACAA UVWXY U VW X Y Les séquences de ADN peuvent aussi être organisées par arbres phylogénétiques C >> G A >> T


86 Fungi Plants Ciliates Flagellates Trichomonads Microsporidia Diplomonads Animals Slime moulds Entamoebae Halophiles Methanosarcina Methanococcus Methanobacterium T. celer Thermoproteus Pyrodictium Green non-sulphur bacteria Gram-positives Purple bacteria Cyanobacteria Flavobacteria Thermotogales Arbre généalogique du vivant (16S/18S rARN) Subunité du ribosome Protéines 16sARN En. 2000 b Escherichia coliMethanococcus vannieliiSaccharomyces cerevisiae

87 Nature 420:520 (2002) Le chromosome 14 de l’homme et le 12 de la souris doivent descendre d'un ancêtre commun: dans un segment d'environ 600,000 bases, on a identifié beaucoup de séquences uniques, extrêmement conservées et positionées dans le même ordre relatif

88 Nature 420:520 (2002) Les chromosomes de la souris sont composés d'un mosaïque de segments exactement homologues aux segments présents aussi sur les chromosomes humains

89 Mais, la plus captivante est la récente évolution des primates !!


91 Arbres phylogénétiques des primates anthropomorphes ChimpanzeeGorillaHumanOrang-utan SivapithecusRamapithecus Old World monkeys ~30MYr ago ChimpanzeeGorillaOrang-utanHumanSivapithecus Ramapithecus Old World monkeys ~30MYr ago Divergence time > 15Myr ago Divergence time ~5Myr ago Depuis les données de protéines Depuis les données de ADN

92 On peut utiliser l'ADN des mitochondries : se transmet uniquement de mère à fille. L’étude de cet ADN a permis de déterminer que l’espèce humaine provient d’un petit groupe ayant vécu en Afrique il y a environ 150 000 ans (en fait d’une femme qui appartenait à ce groupe, on l’a appelée l’Ève africaine). Les mêmes études ont permis de déterminer que la plupart des européens provenaient de sept groupes humains (en fait sept femmes appartenant chacune à un de ces groupes) qui se sont installés en Europe à différentes époques.


94 On peut utiliser l'ADN des mitochondries : se transmet uniquement de mère à fille. On peut utiliser l'ADN du chromosome Y : se transmet uniquement de père à fils.

95 Exemple : Pikaia Pikaia, un chordé primitif, est l’ancêtre de tous les vertébrés qui suivront (poissons, amphibiens, reptiles, oiseaux, mammifères). Pikaia a été découvert dans les shistes de Burgess (Colombie-Britannique, 520 MA, Cambrien). Ce site exceptionnel renferme des fossiles d’organismes à corps mou qui se sont fossilisés (chose rare). Conclusion: on ne peut pas prévoir dans quelle direction se fera l'évolution, il y a trop d'événements impossibles à prévoir qui interviennent. 1 cm

96 Faune de Burgess (Cambrien)

97 Si la vie existe sur d’autres planètes et que son évolution a conduit à l’intelligence et à la technologie, ces êtres intelligents sont-ils semblables à nous?

98 FIN

Télécharger ppt "LA THÉORIE DE L’ÉVOLUTION. Facteurs de l’évolution Selection naturelle 1 Mutation fortuite 2,3 Dérive gènètique 4 1 Darwin, 1856; 2 Muller, 1926; 3 Luria,"

Présentations similaires

Annonces Google