La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

ANALYSE DES GÉNOMES À LA RECHERCHE DE RÉPÉTITIONS EN TANDEM POLYMORPHES : OUTILS DÉPIDÉMIOLOGIE BACTÉRIENNE ET LOCUS HYPERMUTABLES HUMAINS I. G. M Université

Présentations similaires


Présentation au sujet: "ANALYSE DES GÉNOMES À LA RECHERCHE DE RÉPÉTITIONS EN TANDEM POLYMORPHES : OUTILS DÉPIDÉMIOLOGIE BACTÉRIENNE ET LOCUS HYPERMUTABLES HUMAINS I. G. M Université"— Transcription de la présentation:

1 ANALYSE DES GÉNOMES À LA RECHERCHE DE RÉPÉTITIONS EN TANDEM POLYMORPHES : OUTILS DÉPIDÉMIOLOGIE BACTÉRIENNE ET LOCUS HYPERMUTABLES HUMAINS I. G. M Université Paris-Sud France Denoeud

2 I. Introduction : les répétitions en tandem II. La base de données des répétitions en tandem IV. Prédiction du polymorphisme de minisatellites humains III. Recherche de répétitions en tandem polymorphes chez les bactéries V. Conclusions et perspectives I. Introduction : les répétitions en tandem

3 Les répétitions en tandem Il sagit de successions dun motif répété (ex: 4 x 12pb). Les différentes copies sont généralement dégénérées: elles contiennent des mutations. AACTTTACGTTCAAATTAACGTTC AAATTTACCTTG séquences flanquantes Les répétitions en tandem sont présentes dans tous les génomes, eucaryotes comme procaryotes, dans les séquences codantes comme dans les régions non-codantes. Les répétitions en tandem sont soumises à des mécanismes dinstabilité : ces structures sont donc souvent polymorphes (variation du nombre de copies). I

4 Le Flèche et al Intérêts des répétitions en tandem Chez les bactéries - Les répétitions en tandem instables sont impliquées dans les phénomènes de variation de phase et dadaptation à lhôte chez certains pathogènes. Les répétitions en tandem constituent une proportion variable des génomes bactériens, de 1 à 2% en général, mais ce chiffre peut atteindre 10% (B. aphidicola) - Les répétitions en tandem polymorphes sont des outils efficaces pour distinguer les isolats/souches : approche « MLVA » (multiple loci VNTR analysis). I

5 Pourquoi génotyper les souches ? Dans de nombreux domaines, lidentification précise au niveau de la souche est essentielle: Dans le cas dattaques bioterroristes, pour identifier lorigine de la souche employée Pour effectuer un suivi des infections nosocomiales Pour des études épidémiologiques à léchelle planétaire (santé publique) ex: Bacillus anthracis ex: Staphylococcus aureus ex: Mycobacterium tuberculosis I

6 amorces PCR: CTCCCACACCCAGGACAC CGGCCTACCCAACATTCC 100 bp 200 bp 300 bp Migration sur gel Souche CDC1551: 5 x 15 pbSouche H37Rv: 4 x 15 pb souche CDC1551 : 230 pb souche H37Rv : 215 pb 230 pb 215 pb Exemple dune répétition en tandem de Mycobacterium tuberculosis 215 pb 230 pb Utilisation des répétitions en tandem pour le génotypage PCR 200 pb I

7 Marqueurs Souches A B C D E F G H I J K Matrice des distances Reconstruction dun arbre A B C D E F G H I J K Souche inconnue génotypage Identification de la souche la plus proche génotypes Utilisation des répétitions en tandem pour le génotypage I

8 Intérêts des répétitions en tandem Chez lHomme Les répétitions en tandem constituent environ 3% du génome humain ; la plupart sont des microsatellites. - Certaines répétitions en tandem régulent lexpression de gènes - Certains minisatellites, les minisatellites hypermutables, sont extrêmement instables. I - Les répétitions en tandem polymorphes sont utiles en tant que marqueurs génétiques ; utilisation pour la cartographie du génome humain: microsatellites, distribués de façon homogène minisatellites, plus abondants vers les extrémités chromosomiques

9 Une dizaine de minisatellites hypermutables ont été caractérisés Vergnaud & Denoeud 2000 Intérêts des minisatellites hypermutables humains Les premiers minisatellites hypermutables ont été identifiés grâce à létude de familles. Leur taux dallèles mutants est supérieur à 0.5%. Les minisatellites hypermutables sont les éléments les plus instables du génome humain. Afin didentifier dautres minisatellites hypermutables humains, les données de séquençage peuvent être mises à profit. I Intérêt fondamental : étude des mécanismes dinstabilité (points chauds de cassures double-brin à lorigine de linstabilité) Biomarqueurs pour létude de leffet dagents génotoxiques tels que les radiations ionisantes

10 Identification de répétitions en tandem polymorphes dans les génomes - Les séquences génomiques sont disponibles pour un nombre croissant dorganismes. - Il existe des logiciels efficaces de détection des répétitions en tandem dans les séquences (TRF, G. Benson). On peut identifier les répétitions en tandem in silico : Élaboration dune base de données des répétitions en tandem Problématique: Parmi cet ensemble de répétitions en tandem, comment identifier les répétitions en tandem polymorphes ? Marqueurs épidémiologiques bactériens Minisatellites hypermutables humains I

11 I. Introduction : les répétitions en tandem II. La base de données des répétitions en tandem IV. Prédiction du polymorphisme de minisatellites humains III. Recherche de répétitions en tandem polymorphes chez les bactéries V. Conclusions et perspectives II. La base de données des répétitions en tandem

12 Séquences génomiques Description des répétitions en tandem Comparaison de souches Blast dans les TRs et leurs flanquantes sélection de répétitions en tandem Identification de répétitions en tandem polymorphes choix damorces PCR typages PCR Description de TRs déjà étudiées Base de données des répétitions en tandem validation Fonctionnalités de la base de données Tandem Repeats Finder Informations (polymorphisme, conditions PCR) II

13 II

14 La page de requête dans la base de données II

15 I. Introduction : les répétitions en tandem II. La base de données des répétitions en tandem IV. Prédiction du polymorphisme de minisatellites humains III. Recherche de répétitions en tandem polymorphes chez les bactéries V. Conclusions et perspectives III. Recherche de répétitions en tandem polymorphes chez les bactéries

16 La page de comparaison de souches établit la correspondance entre toutes les répétitions en tandem des souches comparées (polymorphes ou non). La comparaison de souches bactériennes Pour de nombreuses bactéries dintérêt médical ou économique, les séquences génomiques de plusieurs souches sont disponibles (ex: 6 pour S. aureus). Elle permet didentifier les répétitions en tandem ayant un nombre de copies différent entre ces souches. III La comparaison de ces souches est la méthode la plus directe pour identifier les répétitions en tandem polymorphes chez ces bactéries.

17 - Certains génomes bactériens sont très remaniés : il est alors impossible de trouver les répétitions en tandem correspondantes en se basant sur leurs positions. III Comment comparer les répétitions en tandem de différentes souches ?

18 - Certains génomes bactériens sont très remaniés : il est alors impossible de trouver les répétitions en tandem correspondantes en se basant sur leurs positions. On ne peut pas comparer directement les répétitions en tandem de la base : nécessité de recourir à un logiciel de recherche de similitude de séquences (BLAST). - Les positions des répétitions en tandem détectées par le TRF ne sont pas toujours comparables (les bornes des répétitions sont difficiles à définir). III

19 Souche ASouche B 1ère étape: Blast des flanquantes des répétitions en tandem de la souche A dans le génome complet de la souche B TRs contenues dans la base de données: flanquantes Répétition en tandem Génome complet: Ltot_A Ltot_B BLAST Méthode de comparaison de souches III

20 Souche ASouche B 2ème étape: Blast des flanquantes des répétitions en tandem de la souche B dans le génome complet de la souche A TRs contenues dans la base de données: flanquantes Répétition en tandem Génome complet: Ltot_B Ltot_A BLAST Méthode de comparaison de souches III

21 BLAST B A B -> A B A -> B A 3ème étape: Synthèse entre la comparaison A -> B et la comparaison B -> A Méthode de comparaison de souches A B Synthèse TR détectées dans les deux comparaisons TR détectées dans une seule comparaison: -pas de match dans une souche - non détectées par le TRF dans une souche Match A->B Pas de Match A->B Match B->A Pas de Match B->A TR éliminées Pas de position sur le génome B Pas de position sur le génome A III

22 Méthode de comparaison de plus de deux souches Exemple: 5 souches A, B, C, D, E La synthèse entre ces comparaisons est effectuée en utilisant les positions sur le génome A. On effectue comme décrit précédemment les comparaisons A B, A C, A D, A E On obtient un tableau faisant correspondre les répétitions en tandem de tous les génomes comparés: A, B, C, D, E. Des requêtes peuvent être effectuées directement sur le nombre dallèles parmi les souches comparées. III

23 La page de comparaison de souches III

24 Conclusions sur le génotypage de souches bactériennes par les répétitions en tandem Lapproche MLVA est de plus en plus reconnue. Elle a déjà été validée pour plusieurs pathogènes humains : Yersinia pestis, Bacillus anthracis, Mycobacterium tuberculosis, Brucella, Burkholderia, Neisseria meningitidis, Legionella pneumophila, Pseudomonas aeruginosa, Staphylococcus aureus Le séquençage de plusieurs souches pour un nombre grandissant despèces et la base de données des répétitions en tandem (http://gpms.igmors.u-psud.fr) devraient faciliter le développement de cette technique. Yersinia pestis Bacillus anthracis Mycobacterium tuberculosis Le Flèche et al Lefficacité de la comparaison de souches reste toutefois très dépendante de la proximité des souches comparées. III Le Flèche et al Le Flèche et al CDC1551 H37Rv M. bovis

25 Cas où la comparaison de souches est impossible (une seule souche séquencée) On peut rechercher des caractéristiques de la seule séquence disponible qui soient corrélées au polymorphisme: Le Flèche et al Lefficacité de tels critères varie toutefois selon lespèce considérée : ils sont difficilement généralisables. Les critères portant sur la longueur totale et la conservation sont les plus universels. III On peut rechercher des caractéristiques de la seule séquence disponible qui soient corrélées au polymorphisme:

26 I. Introduction : les répétitions en tandem II. La base de données des répétitions en tandem IV. Prédiction du polymorphisme de minisatellites humains III. Recherche de répétitions en tandem polymorphes chez les bactéries V. Conclusions et perspectives IV. Prédiction du polymorphisme de minisatellites humains

27 1- Utilisation, comme pour les bactéries, des différentes séquences disponibles: Human Genome Project et C ELERA -Typage dun ensemble de minisatellites afin den dégager des critères corrélés au polymorphisme - Test de ces critères sur un autre ensemble de minisatellites afin de vérifier leur pouvoir prédictif Deux stratégies employées pour faciliter lidentification de minisatellites polymorphes humains 2- Prédiction du polymorphisme à partir de la séquence dun seul allèle: IV

28 Longueur totale > 350 pb Taille du motif > 17 pb Nombre de répétitions > 10 Conservation du motif > 70% Biais GC > minisatellites sur le chromosome minisatellites sur le chromosome minisatellites Les minisatellites étudiés ont été sélectionnés sur les chromosomes 21 et 22 et correspondent à la requête: Sélection des minisatellites IV

29 Chromosome 21: 60 msChromosome 22: 67 ms Répartition des minisatellites IV

30 Résultats des typages - 118/127 minisatellites ont pu être amplifiés par PCR - Seulement une dizaine de minisatellites ont un produit damplification de taille différente à la taille attendue daprès la séquence HGP => bonne qualité de séquence Polymorphisme: 2 mesures du polymorphisme= nombre dallèles et hétérozygotie IV

31 1. Comparaison des séquences HGP-C ELERA IV - Lorsque les séquences CELERA et HGP sont de longueurs différentes, la longueur proposée par CELERA est souvent non observée parmi les allèles typés : ces séquences sont de moins bonne qualité que les séquences HGP. - Il y a un excès de minisatellites de tailles identiques : les séquences CELERA et HGP ne sont pas indépendantes. En effet, les séquences publiques disponibles ont été utilisées pour lassemblage CELERA. La comparaison de séquences nest pas aussi efficace quattendu pour prédire les minisatellites polymorphes

32 1ère étape = apprentissage Echantillon dapprentissage: 48 minisatellites (22 sur le chr21 et 26 sur le chr22) Typage de 96 individus (CEPH): Calcul du taux de polymorphisme (hétérozygotie) Mesure de corrélations entre différentes caractéristiques de la séquence disponible et le polymorphisme Critères prédictifs sur le polymorphisme 2. Prédiction du polymorphisme IV

33 Les plus fortes corrélations sont obtenues pour: - Le pourcentage en GC - Le critère de reconstruction de lhistoire des répétitions HistoryR : il sagit dune mesure de la facilité à reconstruire lhistoire des duplications successives survenues dans la TR. Les corrélations entre les différentes caractéristiques des minisatellites et leur polymorphisme (nombre dallèles et hétérozygotie) ont été calculées: 2. Calcul de corrélations sur léchantillon dapprentissage IV Denoeud et al. 2003

34 2. Prédiction du polymorphisme 2ème étape = test Critères prédictifs sur le polymorphisme Echantillon de test Groupe + : ms prédits par les critères comme étant polymorphes Groupe - : ms non prédits comme étant polymorphes Pour confirmer les critères, les deux groupes devront avoir des taux de polymorphisme significativement différents. IV

35 2. Test des critères retenus %GC > 48%, HistoryR > 0.54 Denoeud et al Le Critère 3 permet de passer de 43% à 59% de minisatellites avec une taux d hétérozygotie > 0.5. Critère 1Critère 2 Critère 3 Les distributions dans les groupes + et - sont significativement différentes pour les 3 critères. IV

36 Exemples de minisatellites très polymorphes IV CEB205 : U=33 pbCEB324 : U=43 pb Hétérozygotie= 0.93 (21 all)Hétérozygotie= 0.94 (27 all)

37 Mise en évidence dallèles mutants Denoeud et al allèles mutants / 556 méioses: taux de mutation allèles mutants / 680 méioses: taux de mutation 0.29 Identification dun minisatellite hypermutable : CEB205 IV

38 I. Introduction : les répétitions en tandem II. La base de données des répétitions en tandem IV. Prédiction du polymorphisme de minisatellites humains III. Recherche de répétitions en tandem polymorphes chez les bactéries V. Conclusions et perspectives

39 Conclusions et perspectives La base de données des répétitions en tandem est un outil pour lidentification, la caractérisation et la capitalisation des connaissances concernant les répétitions en tandem (http://minisatellites.u-psud.fr). Elle a initialement été élaborée afin de répondre aux besoins du laboratoire, puis a été rendue accessible sur Internet afin dêtre utile à la communauté. De nombreuses requêtes y sont effectuées chaque jour par des utilisateurs distants. La base de données sera mise à jour au fur et à mesure du séquençage de nouveaux génomes et il est probable quelle bénéficie dun intérêt croissant (épidémiologistes). V

40 On peut toutefois aller plus loin dans lanalyse en séquençant les allèles : la même résolution pourrait être obtenue avec quelques locus au lieu de la vingtaine de locus employés pour le typage MLVA. Le typage de répétitions en tandem polymorphes est une méthode efficace pour le génotypage de bactéries. Conclusions et perspectives V Nécessité doutils bioinformatiques spécifiques à lanalyse de séquences répétées en tandem

41 Conclusions et perspectives Deux stratégies employées pour identifier les répétitions en tandem polymorphes : 1- Comparaison de génomes: - Appliquée avec succès à différentes espèces bactériennes. - Approche décevante pour le génome humain. 2- Recherche de critères prédictifs de la séquence d1 allèle: - Appliquée avec succès aux minisatellites humains. - Des critères ont également été identifiés pour les bactéries mais ils ne sont pas généralisables. Moins efficace (on nobtient pas 100% de TRs polymorphes) mais applicable lorsquon ne dispose que dune séquence. Nécessite la disponibilité des séquences de plusieurs souches. Lefficacité varie selon la proximité des souches comparées. V

42 Conclusions et perspectives Le critère HistoryR est un bon prédicteur du polymorphisme des minisatellites humains. Ce critère complexe est basé sur un programme de reconstruction des duplications survenues dans la répétition en tandem. Si les mécanismes dévolution étaient mieux compris, ils pourraient être modélisés plus efficacement, ce qui produirait sans doute de meilleurs prédicteurs. Critères corrélés au polymorphisme Mécanismes générant le polymorphisme ? ? V

43 Conclusions et perspectives V Létude de prédiction du polymorphisme de minisatellites humains a permis didentifier un minisatellite hypermutable. La requête HistoryR > 0.88 pourrait être appliquée à tout le génome humain ~200 à 500 minisatellites dont ~20 à 50 hypermutables Critère HistoryR > minisatellites (chr 21 et 22) dont 1 hypermutable 8 minisatellites très polymorphes

44 Conclusions et perspectives V Linstabilité des minisatellites hypermutables semble provenir de la présence dun point chaud de cassures double-brin à proximité: elle ne serait donc pas directement liée aux caractéristiques de séquence des minisatellites. Pour rechercher des minisatellites hypermutables (plutôt que polymorphes), il serait intéressant de prendre en compte la séquence avoisinante. Létude de prédiction du polymorphisme de minisatellites humains a permis didentifier un minisatellite hypermutable.


Télécharger ppt "ANALYSE DES GÉNOMES À LA RECHERCHE DE RÉPÉTITIONS EN TANDEM POLYMORPHES : OUTILS DÉPIDÉMIOLOGIE BACTÉRIENNE ET LOCUS HYPERMUTABLES HUMAINS I. G. M Université"

Présentations similaires


Annonces Google