La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Étude du décalage de phase de lecture dans le génome de Saccharomyces cerevisiæ Michaël Bekaert Université Pierre et Marie Curie Directeur de thèse : Jean-Pierre.

Présentations similaires


Présentation au sujet: "Étude du décalage de phase de lecture dans le génome de Saccharomyces cerevisiæ Michaël Bekaert Université Pierre et Marie Curie Directeur de thèse : Jean-Pierre."— Transcription de la présentation:

1 Étude du décalage de phase de lecture dans le génome de Saccharomyces cerevisiæ Michaël Bekaert Université Pierre et Marie Curie Directeur de thèse : Jean-Pierre Rousset Institut de Génétique et Microbiologie

2 La levure Saccharomyces cerevisiae

3 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU ribosome ARNm La traduction ARNt

4 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU La traduction

5 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU La traduction

6 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU La traduction

7 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU La traduction

8 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU La traduction

9 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU La traduction

10 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU La traduction

11 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU La traduction

12 Un messager, un polypeptide P A E CAU AUG GAU UAC AUG GUC UAA GAU La traduction

13 Le recodage Saut de ribosome Translecture Décalage de phase de lecture en -1 Décalage de phase de lecture en +1

14 Un messager, deux polypeptides Le recodage Dépend de séquences et de structures sur lARNm Observé principalement dans des petits éléments génétiques autonomes (virus et transposons) Vestige dun monde à ARN… Compacité des génomes Biais des analyses Pourquoi des virus et des transposons ?

15 Recherche de sites de décalage de phase de lecture dans les génomes Le décalage de phase de lecture en -1 Développer des outils didentification dévénements de recodage eucaryote Caractériser le décalage de phase de lecture en -1

16 Virus HIV Le décalage de phase de lecture en -1. rev tat nef vif vpr vpu pol proenv gag LTR int ARNm

17 Le décalage de phase de lecture en -1 gag pol Protéine Gag 95% Protéine Gag-Pol 5%

18 Site canonique de décalage de phase de lecture Le décalage de phase de lecture en -1 Modèle Jacks et Varmus, 1985 et X XXY YYZ Heptamère Brilerly, 1993

19 Les expériences Décalage de phase de lecture en -1 Nouveaux gènes Mécanisme Impact de lenvironnement Virus Site E HMM Modélisation Similarité Espaceur Transposons Levure

20 Aujourdhui Nouveaux gènes Virus Site E HMM Similarité Décalage de phase de lecture en -1 Mécanisme Impact de lenvironnement Modélisation Espaceur Transposons Levure

21 Recherche de sites de décalage de phase de lecture dans les génomes Le décalage de phase de lecture en -1 Recherches à partir de ce modèle Hammell et al., 1999 Liphardt,

22 Deux approches complémentaires Le décalage de phase de lecture en -1 Modèle pas assez précis (ou incomplet) Modèle trop rigide (mécanismes différents ou dégénérés) Affiner le modèle Approche sans a priori sur le mécanisme

23 Affiner le modèle Le décalage de phase de lecture en -1 Identifier de nouveaux attributs Composition de lespaceur Dissymétrie entre un appariement C-G et G-C (Bekaert et al., Bioinformatics, 2003)

24 Recherche basée sur le modèle affiné Le décalage de phase de lecture en -1 X XXY YYZ P SP S1 L1L1 S2S2 L2L2 L 1 5 3

25 Rechercher un heptemère Le décalage de phase de lecture en -1 AUG N NNN NNXXXYYYZ

26 Rechercher un pseudonoeud Le décalage de phase de lecture en -1

27 Affiner le modèle Le décalage de phase de lecture en -1 X XXY YYZ P SP S1 L1L1 S2S2 L2L2 L 1 5 3

28 Valider des sites putatifs (Bekaert et al., Mol Cell, sous presse) Le décalage de phase de lecture en -1 Cucurbit aphid-borne yellows virus Turnip yellows virus Potato leafroll virus Cereal yellow dwarf virus-RPV Cocksfoot mottle virus Human T-cell lymphotropic virus 1 Simian T-cell lymphotropic virus 1 Bovine leukemia virus Mouse mammary tumor virus Enzootic nasal tumor virus Simian type D Rous sarcoma virus Visna virus Feline immunodeficiency virus Equine infectious anemia virus Human immunodeficiency virus 2 Simian immunodeficiency virus Simian retrovirus type 2 Human immunodeficiency virus 1 L-A virus Giardia virus Trichomonas vaginalis virus II Human astrovirus PRRSV Human coronavirus Murine hepatitis virus SARS Avian infectious bronchitis virus Red clover necrotic mosaic virus Barley yellow dwarf virus-PAS Carrot mottle mimic virus Groundnut rosette virus Pea enation mosaic virus 2 Human T-cell lymphotropic virus 2 Mason-Pfizer monkey virus Coronaviridae Coronavirus Arteriviridae Arterivirus Astroviridea Mamadtroviruss Tombusviridea Dianthovirus Umbravirus Luteoviridea Polerovirus Luteoviridae Luteovirus Retroviridea Deltaretrovirus Retroviridea Betaretrovirus Retroviridea Alpharetovirus Retroviridea Lentivirus Totiviridae Totivirus Totiviridae Giardiavirus Retrovirus Virus à ARN double brin Virus à ARN positif

29 pAC99 : évaluation in vivo Le décalage de phase de lecture en -1 -galactosidase -galactosidase-luciférase Région de décalage lacZ luc +1 0

30 Plus de virus Le décalage de phase de lecture en -1 Pseudo-consensus 13,0%±2SRV1 gag/pro 0,7%±0ScYLV 10,3%±1SARS 15,7%±1PRRSV 17,8%±2PLRV-W 19,0%±1PLRV 31,0%±2PEMV1 20,2%±2MMTV gag/pro 13,1%±1LDV 13,0%±2L-BC 10,0%±1L-A 19,3%±1IBV 6,0%±1HIV1 9,0%±1FIV 7,0%±1EIAV 17,5%±1CABYV 12,2%±1BYDV 12,0%±1BWYV 8,1%±1BLV gag/pro 15,8%±2BChV GGG GGGAAAC UC gGa.GGgAAAC.ca gaG.GGgAAAu.ca gGG.uuuAAAC.Uu UGc.uuuAAAC.Ug gGG.uuuAAAu.cC gGG.GGgAAAu.cC gGa.GGgAAAC.UC UuG.aaAAAAC.UC UGc.uuuAAAC.gC cGu.GGauuuu.Uu gGa.GGguuua.ca gGG.uuuAAAC.Ua gGG.uuuuuua.aa UGG.GGgAAAC.UC gGG.aaAAAAC.cC gGG.GGgAAAC.UC UaG.GGguuuu.gu gGG.GGgAAAC.UC Uaa.aaAAAAC.UC gGa.GGgAAAu.cC HeptamèreDécalageVirus Profil HMM

31 Identifier de nouveaux virus Le décalage de phase de lecture en génomes 285 candidats 74 séquences profil HMM inspection manuelle - pas dans la bonne phase - pas de structure secondaire

32 biais nucléotidique Le décalage de phase de lecture en /-10-8/-9-7/-8-6/-7-5/-6-4/-5-3/-4-2/-3-1/-2 dinucléotide Chi2

33 Dinucléotide en amont du site glissant Le décalage de phase de lecture en -1

34 Dinucléotide en amont du site glissant Le décalage de phase de lecture en -1 0% 5% 10% 15% 20% 25% AAACUAUCUGUUAGAUCACCCGCUGAGCGGGU dinucléotide Taux décalage de phase

35 Propriété de Pus3p Le décalage de phase de lecture en -1 Réaction catalysée par Pus3p

36 Effet de labsence de pseudouridine en position 39 Le décalage de phase de lecture en -1 0% 5% 10% 15% 20% 25% CGGAUAUC WT pus3 dinucléotide taux de décalage de phase

37 Et le site E ? Le décalage de phase de lecture en -1 P A E

38 La traduction Influence de lARNt au site E sur la traduction Adapté de Frank et al., 1999

39 Un site de décalage de phase étendue… Le décalage de phase de lecture en -1 LARNt est éjecté prématurément ? LARNt reste? Influence de la pseudouridine sur le lARNt au site E Influence la phase daccommodation au site A ? Déstabilise lARNt au site P ? Influence de lARNt au site E

40 Le décalage de phase de lecture en -1 Affiner le modèle : mécanisme Influence de la modification 39 de lARNt au site E Impact sur la fidélité de la traduction

41 Le décalage de phase de lecture en -1 Affiner le modèle : bioinformatique Identifier de nouveaux attributs Composition de lespaceur Dissymétrie entre un appariement C-G et G-C Site E / Dinucléotide en amont de lhepamère

42 Approches sans a priori sur le mécanisme Le décalage de phase de lecture en -1 Regarder le décalage de phase sous un angle différent Identifier de nouveaux sites sans a priori sur le site de décalage lui-même définition génomique Fonctionnel Linguistique/statistique

43 Implémentation Le décalage de phase de lecture en -1 Stockage des séquences Découpage du génome HMM Motifs RT-PCR Evaluation in vivo Classement

44 Quelques outils Le décalage de phase de lecture en -1 (Bekaert et al., Bioinformatics, soumis)

45 Découpage Le décalage de phase de lecture en -1 START > 99 nt STOP 1 STOP 2 STOP 3 phase 0 phase -1 > 99 nt > 150 nt ORF0 ORF régions chez S. cerevisiae Genbank – rel. 27/10/ régions chez le virus L-A Genbank – rel. 03/08/2002

46 Motifs Le décalage de phase de lecture en -1 START Motif protéique ? STOP 1 STOP 2 STOP 3 Motif protéique ? ORF0 ORF-1 84 régions chez S. cerevisiae 1 région chez le virus L-A Banques de motifs: Interpro 7.0 Application: GenRecode

47 Modèle de Markov Le décalage de phase de lecture en

48 Modèle de Markov Le décalage de phase de lecture en

49 Classement Le décalage de phase de lecture en régions chez S. cerevisiae 1 région chez le virus L-A Probabilité de déphasage > 95% probabilité Nombre de régions

50 Vers de nouveaux sites eucaryotes : synthèse Le décalage de phase de lecture en Le site du virus L-A est retrouvé Identification de 189 régions chez S. cerevisiae Classement des candidats HMM Motifs

51 ARNm Le décalage de phase de lecture en -1 ADN ARNm AAAAAA 2 MM RT-PCR kb 500 b

52 pAC99 : évaluation in vivo Le décalage de phase de lecture en -1 -galactosidase -galactosidase-luciférase Région de décalage lacZ luc +1 0

53 Décalage in vivo Le décalage de phase de lecture en -1 0% 2% 4% 6% 8% 10% 12% 14% HMM Motifs candidat Taux décalage de phase 3 6 2

54 De nouveaux sites eucaryotes ? Le décalage de phase de lecture en -1 Stockage des séquences Découpage du génome HMM Motifs RT-PCR Evaluation in vivo Classement 1 génome régions 110 candidats 84 candidats 28 ARNm /50 11 sites /28

55 Les 11 candidats Le décalage de phase de lecture en -1 fsORF%SageCanoniqueORF0ORF-1Notes 26%OuiheptamèreSCO2-SCO2 (involved in stability of Cox1p and Cox2p) 1111%OuiheptamèreYDL038CPRM7PRM7 (pheromone-regulated membrane protein) 169%--AAD6AAD16AAD6 (high similarity with the AAD of P. chrysosporium) 2113%-Oui--Intergénique / PRF %Oui-YKL033W-A-- 327%Oui-SRL3SRL3 (Suppressor of Rad53 null Lethality) 405%--YMR084WYMR085Wputative glutamine--fructose-6-phosphate transaminase 415%Oui-ADE17-ADE17 (AICAR transformylase/IMP cyclohydrolase) 4310%--MRPL24-MRPL24 (Mitochondrial ribosomal protein) 485%Oui-STE4-STE4 (GTP-binding protein beta subunit of the pheromone pathway) 507%Oui--RAD17RAD17 (DNA damage checkpoint control protein)

56 Perspectives Le décalage de phase de lecture en -1 Recherche dans dautres levures Recherche dans des organismes plus complexes Cette stratégie peut être appliquée à dautres organismes. Applicable à dautres types de recodage. Décalage de phase de lecture en +1 Translecture Nouveaux types de recodage

57 Analyse des génomes Le décalage de phase de lecture en -1 Le décalage de phase de lecture en -1 nest pas un phénomène limité aux gènes viraux, il pourrait être sous-évalué dans les génomes eucaryotes. HMM Motifs

58 Analyse des génomes Le décalage de phase de lecture en -1 Rôle du site E Modèle de site de décalage plus détaillé Nouveaux sites viraux Identification de sites fonctionnels chez S. cerevisiae

59 Merci !!! Institut de Génétique et Microbiologie Laboratoire de Recherche en Informatique Laboratoire de Statistique et Génome Agnès Baudin-Baillieu Laure Bidou Bruno Cosnier Muriel Decraene Céline Fabret Maryse Godon Isabelle Hatin Marta Kwapisz Olivier Namy Jean-Pierre Rousset Michel Termier Alain Denise Jean-Paul Forest Christine Froidevaux Bernard Prum Hugues Richard


Télécharger ppt "Étude du décalage de phase de lecture dans le génome de Saccharomyces cerevisiæ Michaël Bekaert Université Pierre et Marie Curie Directeur de thèse : Jean-Pierre."

Présentations similaires


Annonces Google