La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

LA MATIERE ET LA VIE. 1 - La matière et ses niveaux dorganisation.

Présentations similaires


Présentation au sujet: "LA MATIERE ET LA VIE. 1 - La matière et ses niveaux dorganisation."— Transcription de la présentation:

1 LA MATIERE ET LA VIE

2

3

4

5 1 - La matière et ses niveaux dorganisation

6 Structure de la matière : ATOMES et MOLECULES

7 Atome : 1 noyau (protons et neutrons) un nuage délectrons

8 Plusieurs atomes saccrochent et forment une MOLECULE

9

10

11 La molécule la plus complexe : L ADN

12 Les molécules complexes peuvent transmettre de linformation

13 ligand Zone réceptrice Membrane cellulaire

14 2 - La matière vivante

15 Est vivante une structure qui : 2) est capable de se reproduire 1) est capable dorganiser la matière

16 3 – les niveaux dorganisation

17 Les molécules se groupent et forment des CELLULES Les cellules remplissent des fonctions

18

19

20

21

22 Les cellules à fonctions complémentaires se groupent et forment des ORGANES Les organes remplissent des fonctions

23 Exemple de lestomac Cellules musculaires Cellules nerveuses Cellules sécrétrices dacide Cellules à mucus Artères et veines

24 coeur

25

26 Les organes à fonctions complémentaires se groupent et forment des systèmes (= appareils) Les systèmes remplissent des fonctions

27 Dissection de souris

28 Un grand nombre de systèmes à fonctions complémentaires forment un organisme

29 Thorax humain

30

31 Dautres niveaux existent Populations Écosystème local (ex : mare) Écosystème général

32 4 - Les 7 caractéristiques de la VIE

33 4.1 – ORGANISATION COMPLEXE

34 Squelette de la main

35 4.2 – REPRODUCTION

36 Bactéries en cours de mitose

37 Chatte et chaton femelle chimpanzé et son jeune

38 4.3 – CROISSANCE ET DEVELOPPEMENT

39 Poissons adulte et jeune

40 Embryons de poisson batracien reptile oiseau mammifère

41 4.4 – ADAPTATION à LENVIRONNEMENT

42 Ficus temple Angkor-vat

43 HOMEOSTASIE = stabilité

44 4.5 – REACTIONS A LENVIRONNEMENT

45 Chauve-souris

46 Antennes papillon de nuit

47 4.6 – EVOLUTION

48 DARWIN : 1809 – 1882 Dates importantes : 1831 – 1836 : voyage du Beagle 1859 : « Sur lorigine des espèces par le mécanisme de la sélection naturelle » 1871 : « la lignée humaine » Photo Darwin

49 Le « beagle » en mer

50 Voyage de Darwin

51 Pinsons de Darwin

52 -1) à tout moment il existe, entre les individus dune même espèce, des variations morphologiques, physiologiques et comportementales. -2) certaines de ces variations ont, au moins partiellement, une base héréditaire

53 - 3) les êtres vivants ont une énorme capacité de reproduction ; or, dans les conditions normales, leur nombre tend à rester globalement constant de génération en génération ceci résulte de la compétition qui sinstaure entre les individus en vue de lacquisition des ressources disponibles dans le milieu, qui sont limitées.

54 -4) le résultat de cette compétition est que certains individus, mieux armés dans la lutte pour lacquisition des ressources, auront plus de descendants que les autres ; ils transmettront à ces descendants leurs capacités, et ainsi lespèce sadaptera de mieux en mieux, de génération en génération, par ce phénomène de sélection naturelle.

55 Lignée humaine

56 4.7 – TOUTES CES PROPRIETES SONT POSSIBLES GRACE A LA CIRCULATION DE LENERGIE

57 4.7 – a) Homéostasie, croissance et réactions à lenvironnement nécessitent de la matière et de lénergie

58 Thermographie thorax humain

59 Thermographie chien

60 Lion et lionceau

61 Rapace Et lapin

62 4.7 – b) matière et énergie circulent le long des chaînes trophiques

63 Le premier niveau est constitué par les plantes chlorophylliennes qui utilisent lénergie de la lumière solaire

64 Les plantes chlorophylliennes sont des êtres vivants AUTOTROPHES

65 Puis matière et énergie circulent de niveau en niveau

66 Exemple dêtres vivants HETEROTROPHES (vaches)

67 steack

68 Ventre plat

69 piéride

70 merle

71 chat

72 Les saprophytes utilisent la matière organique en décomposition champignons

73 On récupère de lénergie en brisant les liaisons entre les atomes des molécules

74 LA CELLULE : unité fondamentale de la vie XVIIème Robert Hook 1er microscope (X30) XVIIème : Antoon Leewenhoek : microscope (X300) XXème : microscope électronique (X )

75 LA CELLULE : Une membrane Un cytoplasme Un noyau

76 LA CELLULE : Une membrane sépare le cytoplasme du milieu extérieur ligands porte des récepteurs sensibles à certains ligands Un cytoplasme Un noyau

77 LA CELLULE : Une membrane sépare le cytoplasme du milieu extérieur ligands porte des récepteurs sensibles à certains ligands Un cytoplasme organites gel contenant en suspension des organites Un noyau

78 LA CELLULE : Une membrane sépare le cytoplasme du milieu extérieur ligands porte des récepteurs sensibles à certains ligands Un cytoplasme organites gel contenant en suspension des organites Un noyau contient le matériel génétique

79 Schéma cellule

80 cytosquelette

81 Épiderme oignon

82 Caryotype humain

83 5 Les molécules de la vie

84 Glucides Lipides Protéines Acides nucléiques

85 5 - 1 Les glucides

86 ribose

87 glucose

88 Glucides : Énergie rapide Génétique (ADN = acide désoxyribonucléique) Synthèse des protéines (ARN = acide ribonucléique)

89 Formes de stockage : Amidon (plantes) Glycogène (animaux)

90 La glycémie est la concentration en glucose du sang (valeur normale à jeun : 1g/litre Mesure de la glycémie

91 Bouteille coca

92 Bouteille coca et sucres

93 Yaourts aux fruits

94 5 - 2 Les lipides

95 Lipides : Réserve dénergie Membrane cellulaire Stéroïdes sexuels

96 Lipides 1 – réserve dénergie

97 Lipides : Réserve dénergie Les lipides en excès sont stockés dans les lipocytes

98

99 - 2 - Les phospholipides :

100 Les phospholipides sont un constituant essentiel de la membrane cellulaire

101 Les hormones sexuelles testostérone oestradiol H3CH3C

102 Les hormones sexuelles testostérone oestradiol

103 5 - 3 Les protéines

104 Protéines : Rôles très nombreux Constitutifs de lorganisme Transport de substances Enzymes (métabolisme) Hormones Mouvement immunité

105 Les protéines Éléments de base : acides aminés Les acides aminés

106 Il existe 20 acides aminés Ex : glycine, sérine, tryptophane, …

107 Acide aminé : élément de base des protéines

108 Carbone central

109 Atome dhydrogène

110 NH2 : radical AMINE Carbone central Atome dhydrogène

111 NH2 : radical AMINE Carbone central Atome dhydrogène CO OH : radical HYDROXYLE

112 NH2 : radical AMINE Carbone central Atome dhydrogène CO OH : radical HYDROXYLE Chaîne latérale

113 H N H O OH C GLYCINE TRYPTOPHANE

114 Des acides aminés aux protéines : La liaison peptidique

115 legos

116 1 acide aminé Des acides aminés à la protéine : Liaison peptidique -1-

117 1 acide aminé Des acides aminés à la protéine : Liaison peptidique -1-

118 Des acides aminés à la protéine : Liaison peptidique -2-

119 Des acides aminés à la protéine : Liaison peptidique -3-

120 Des acides aminés à la protéine : Liaison peptidique -4-

121 Des acides aminés à la protéine : Liaison peptidique -5-

122 Des acides aminés à la protéine : Liaison peptidique -6- protéine eau

123

124 O H H C C N OH R H O H H C C N OH R H + Acide aminé 1Acide aminé 2 +

125 O H H C C N OH R H O H H C C N OH R H + Acide aminé 1Acide aminé 2 +

126 O H H C C N OH R H O H H C C N OH R H + H2OH2O O H H C C N OH R O H H C C N R H Acide aminé 1Acide aminé 2 + eau protéine

127 Les différents niveaux d'organisation d'une protéine 4 niveaux de complexité croissante

128 1 er niveau : La SEQUENCE = ordre denchaînement des acides aminé

129 alanine proline tyrosine alanine tyrosine leucine lysine histidine tryptophane glycine tryptophane ALA – PRO – TYR – ALA –LEU – LEU – LYS – HIS …

130 2ème niveau : STRUCTURE SECONDAIRE = hélice et feuillet

131 Hélice et feuillet

132 Exemple dhélice

133 3ème niveau : STRUCTURE TERTIAIRE les cystéines forment des ponts disulfures

134 cystéine

135 Les ponts disulfures obligent la protéine à se replier sur elle-même et à prendre une structure complexe

136 4ème niveau : STRUCTURE QUATERNAIRE plusieurs sous-unités sassemblent

137 Structure quaternaire ex : hémoglobine

138 Exemple de structure quaternaire

139 La complexité de structure des protéines en fait des molécules porteuses dinformation

140 2 exemples importants : neuro-transmission La neuro-transmission (les récepteurs sont des protéines) hormonal Le fonctionnement hormonal (cas des hormones protéiques)

141 Membrane du neurone pré-synaptique Membrane du neurone post- synaptique récepteur Molécules de neuro-transmetteur

142 synapse

143 Membrane cellulaire récepteur cellule Molécules dhormone sang Modifications du fonctionnement de la cellule

144 Rôle des protéines dans la synthèse de nouvelles molécules : enzymes Les enzymes

145 Problème : on veut fabriquer une nouvelle molécule à partir de constituants séparés dans la cellule

146

147 ENZYMEPROTEINE Une ENZYME est une PROTEINE SITES qui possède 2 SITES particuliers Site 1 Site 2

148

149 Les 2 constituants se fixent sur lenzyme

150 Une liaison chimique se forme

151 La nouvelle molécule se détache Lenzyme est prête pour une nouvelle synthèse

152 En contrôlant le nombre de molécules denzyme, la cellule contrôle lintensité de la synthèse La fabrication des enzymes dépend du code génétique

153 LES ACIDES NUCLEIQUES ADN et ARN

154 – Les constituants de base DES ACIDES NUCLEIQUES

155 sucre phosphore bases adéninethymine cytosine guanine uracile A T C G U Ribose (ARN) ou Désoxyribose (ADN)

156 Les nucléotides ADN ARN A D P U R P G D P C D P T D P C R P A R P G R P

157 L ADN

158 ADN A D G D D C A D P P P P

159 A D G D D C A D P P P P T D C D T D G D P P P P

160 A D G D D C A D P P P P T D C D T D G D P P P P (bicaténaire)

161 Structure de lADN : La double hélice

162 L ARN

163 sucre phosphore bases adéninethymine cytosine guanine uracile A T GC U Ribose (ARN) ou Désoxyribose (ADN)

164 ADN A D G D D C D P P P P T

165 A D G D D C A D P P P P T D C D T D G D P P P P

166 ARN A R G R R C R P P P P n Par rapport à lADN : 1)Le désoxyribose est remplacé par du ribose 2) La thymine est Remplacée par de lURACILE 3) lARN est souvent monocaténaire

167 – La réplication de lADN

168 réplication de lADN A D P D C P G D P A D P T D C D P P G D P T D P 1 - Ouverture de la chaîne

169 réplication de lADN A D P D C P G D P A D P T D C D P P G D P T D P T D P 2 - assemblage

170 A TT AA TG CC GA TC GT AG CG CG CT AA TA TT AA TG CC GA TC GT AG CG CG CT AA T A T T A A T G C C G A T C G T A G C TA AT T A A T G C C G A T CG TA GC TA AT TA AT GC CG AT CG TA GC TA AT 2 molécules dADN identiques 1 molécule1 dADN

171

172 La réplication de lADN permet la reproduction cellulaire : 1 cellule-mère donne 2 cellules-filles qui ont des patrimoines génétiques identiques

173 Les gènes

174 Définition : Un gène est un fragment dADN, donc un enchaînement de nucléotides. Il contient linformation nécessaire à la fabrication dune protéine ( cette protéine pouvant être une protéine structurale, une enzyme …)

175 Séquençage du génome = Établir la liste des gènes dun organisme + Établir le liste ordonnée des bases qui constituent chaque gène Espèce humaine = environ gènes

176

177

178 premier exercice de génétique Phénotype « yeux bleus »

179

180 PIGMENT BLEU

181 divers constituants Synthèse de PIGMENT BLEU +

182 divers constituants Synthèse de PIGMENT BLEU + ENZYME (protéine)

183 divers constituants Synthèse de PIGMENT BLEU + ENZYME (protéine ) GENE

184 PATERNEL MATERNEL + PIGMENT BLEU CHROMOSOMES 2 gènes identiques : sujet HOMOZYGOTE

185 PATERNEL MATERNEL + PIGMENT BLEU PIGMENT NOIR CHROMOSOMES 2 gènes différents : sujet HETEROZYGOTE

186 Un point de vocabulaire : Gène DOMINANT Gène RECESSIF Génotype phénotype

187 Le caractère NOIR lemporte sur le bleu : il est dit « DOMINANT » Le caractère bleu est dit « RECESSIF » PATERNEL MATERNEL + PIGMENT BLEU PIGMENT NOIR 2 gènes différents : sujet HETEROZYGOTE YEUX NOIRS

188 PATERNEL MATERNEL + PIGMENT BLEU PIGMENT NOIR 2 gènes différents : sujet HETEROZYGOTE PATERNEL MATERNEL + PIGMENT BLEU PATERNEL MATERNEL + PIGMENT NOIR 2 caractères NOIRS : sujet HOMOZYGOTE DOMINANT 2 caractères BLEUS : sujet HOMOZYGOTE RECESSIF

189 LA TRANSMISSION DES CARACTERES

190 Spermatozoïdes 23 chr. RAPPEL : LES GAMETES (ovules et spermatozoïdes) NE CONTIENNENT QUE LA MOITIE DES CHROMOSOMES Ovules 23 chr Homme adulte 46 chr. femme adulte 46 chr. FECONDATION 46 chr.

191 spermatozoïdes Yeux bleus

192 spermatozoïdes ovules Yeux bleus

193 spermatozoïdes ovules Yeux bleus

194 spermatozoïdes ovules Yeux bleus

195 spermatozoïdes Yeux noirs

196 ovules Yeux bleus spermatozoïdes

197 ovules Yeux bleus spermatozoïdes

198 ovules Yeux bleus spermatozoïdes

199 ovules Yeux noirs spermatozoïdes Yeux noirs

200 ovules Yeux noirs spermatozoïdes Yeux noirs

201 ovules Yeux noirs spermatozoïdes Yeux noirs

202 LES GROUPES SANGUINS

203 A A A AA A A AA A A A Anti-B ANTIGENE A AGGLUTININE ANTI-B

204 Il existe 2 sortes dantigènes sur les hématies : A et B Il existe 2 sortes dagglutinines dans le plasma : anti-A et anti-B A A A A B B B B Anti-A Anti-B

205 A A A AA A A AA A A A B B B BB B B BB B B B A A B BB A A AB B B A Groupe A Groupe B Groupe AB Groupe O

206 A A A AA A A AA A A A B B B BB B B BB B B B A A B BB A A AB B B A Groupe A Groupe B Groupe O « donneur universel » Anti-B Anti-A Anti-B Anti-A Anti-B Anti-A Groupe AB « receveur universel »

207 B B B B B B B B B B B B B B B B TRANSFUSION DE SANG « B » CHEZ UN RECEVEUR A Anti-B DESTRUCTION DES HEMATIES DU SANG TRANSFUSE CHOC TRANSFUSIONNEL Anti-B

208 A B AB O oui D O N N E U R non oui non oui A AB B O RECEVEURRECEVEUR

209 LHEREDITE DES GROUPES SANGUINS A et B dominent O AA et AO groupe A BB et BO groupe B AA et BB groupe AB OO O AO A O AA AO OO OO O O AO B O AB BO AOOO

210 La synthèse des protéines

211 ADN ARNm PROTEINE transcription traduction noyau cytoplasme

212 la transcription ADN ARNm (gène)

213 AAATTGCTAGCTATGCTGCTACGTTACCGGTAGCTTAAG TTTAACGATCGATACGACGATGCAATGGCCATCGAATTC brin codant brin matrice gène

214 EXON 1 INTRON EXON 2 INTRON EXON 3 I NTRON EXON 4 site promoteur séquence transcrite Site de terminaison Séquence -35 : T T G A C A Séquence -10 : T A T A T T Détermine le brin codant Détermine le point de début de transcription

215 CTATGCTGCTACGTTAC GATACGACGATGCAATG

216 CTATGCTGCTACGTTAC G ACGATGCAATG G C A T A 1 – ouverture de lADN

217 CTATGCTGCTACGTTAC G ACGATGCAATG C G G C U A A T U A ARN prémessager 2 - début de la Synthèse de lARN prémessager

218 CTATGGTGCTACGTTAC GATACCA ATG UGCUAC A G CGATGC G U A U 3 – progression de la synthèse de lARN prémessager

219 CTATGGTGCTACGTTAC GATACCACGATGCAATG UAUGGUGCUACGUUA 4 – fin de la synthèse de lARN prémessager

220 gène EXON 1 INTRON EXON 2 INTRON EXON 3 I NTRON EXON 4 ARN prémessager

221 gène EXON 1 INTRON EXON 2 INTRON EXON 3 I NTRON EXON 4 ARN prémessager excision

222 gène EXON 1 INTRON EXON 2 INTRON EXON 3 I NTRON EXON 4 ARN prémessager excision épissage ARN messager

223 ADN ARNm transcription noyau cytoplasme

224 ADN ARNm PROTEINE transcription traduction noyau cytoplasme

225 la traduction ARNm PROTEINE

226 Lieu de la synthèse : les RIBOSOMES

227 Grosse sous-unité petite sous-unité RIBOSOME

228

229 4 bases : A U G C20 acides aminés Comment établir la correspondance ?

230 4 bases : A U G C20 acides aminés Comment établir la correspondance ? 1 bases : 4 possibilités A U G C

231 4 bases : A U G C20 acides aminés Comment établir la correspondance ? 1 bases : 4 possibilités A U G C 2 bases : 16 possibilités AA AU AG AC UA UU UG UC...

232 4 bases : A U G C20 acides aminés Comment établir la correspondance ? 1 bases : 4 possibilités A U G C 2 bases : 16 possibilités AA AU AG AC UA UU UG UC... 3 bases : 64 possibilités AAA AAU AAG AAC AUA AUU AUG AUC AGA AGU AGG AGC ACA ACU ACG ACC...

233 Sur lARN messager, chaque Acide Aminé est représenté par un TRIPLET de bases = un CODON LA LISTE DES CODONS ET DE LEURS CORRESPONDANCES EN ACIDES AMINES CONSTITUE LE CODE GENETIQUE CE CODE EST UNIVERSEL

234 1 2 3 REDONDANCE

235 U A C Acide aminé ARN de transfert Site daccrochage de lacide aminé Anti-codon

236 A U G C U U C G U G U U Met Leu Arg Val

237 A U G C U U C G U G U U Met Leu Arg Val U A C MET

238 A U G C U U C G U G U U Met Leu Arg Val U A C MET

239 A U G C U U C G U G U U Met Leu Arg Val U A C MET G A A LEU

240 A U G C U U C G U G U U Met Leu Arg Val U A C MET G A A LEU G C A ARG

241 A U G C U U C G U G U U Met Leu Arg Val U A C MET G A A LEU G C A ARG C A A VAL

242 A U G C U U C G U G U U Met Leu Arg Val U A C MET G A A LEU G C A ARG C A A VAL

243 A U G C U U C G U G U U Met Leu Arg Val U A C MET G A A LEU G C A ARG C A A VAL

244 ribosome

245 CTATGGTGCTACGTTAC GATACCACGATGCAATG UAUGGUGCUACGUUA 1 er facteur damplification : fabriquer de nombreux ARNm lors dune seule ouverture de lADN

246 ARNm ribosomes protéine 2 ème facteur damplification : lecture par un grand nombre de ribosomes

247 Protéine brute protéine fonctionnelle : LA MATURATION DES PROTEINES

248 Schéma cellule

249 RETICULUM : Maturation de la protéine

250 PROTEINE : de STRUCTURE FONCTIONNELLE enzyme transport exportée

251 PROTEINE : de STRUCTURE FONCTIONNELLE enzyme transport exportée hormone … Contrôle dune réaction chimique


Télécharger ppt "LA MATIERE ET LA VIE. 1 - La matière et ses niveaux dorganisation."

Présentations similaires


Annonces Google