La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

1 Génétique Cours 1 DCEM1 Brigitte Benzacken ; Cytogénétique GHU Nord Marion Gérard ; Génétique Robert Debré Bénédicte Gérard; Biologie Moléculaire RDebré

Présentations similaires


Présentation au sujet: "1 Génétique Cours 1 DCEM1 Brigitte Benzacken ; Cytogénétique GHU Nord Marion Gérard ; Génétique Robert Debré Bénédicte Gérard; Biologie Moléculaire RDebré"— Transcription de la présentation:

1 1 Génétique Cours 1 DCEM1 Brigitte Benzacken ; Cytogénétique GHU Nord Marion Gérard ; Génétique Robert Debré Bénédicte Gérard; Biologie Moléculaire RDebré

2 2 Génétique DCEM Généralités :Modes de transmission Mucoviscidose Myopathie de Duchenne X Fragile

3 3 Maladie génétique... u Recouvre de nombreux aspects u Chromosomique u Rappel: sur un chromosome, il y a entre 400 et gènes !! u Mendélienne u Rappel: il y a environ 4000 maladies mendéliennes monogéniques répertoriées u Moléculaire u Séquençage du génome terminé (90% euchromatine) u Nombre de gènes estimés à

4 4 Patrimoine génétique u Dans le noyau u 46 chromosomes u Molécule d ADN replié très serrée !!! u Filament long +++ u Reployé en boucles resserrées, qui souvrent au moment de la réplication de lADN u Chromosomes visibles dans le noyau pendant la mitose u Initialement décondensés u Puis compactés

5 5

6 6

7 7 Chromosomes et gènes... u 46 chromosomes u gènes u Pour un gène, deux allèles u 1 hérité du père u 1 hérité de la mère u 1300 en moyenne par chromosome… u Bandes u Sombres, riches en gènes

8 8 ADN reployé +++

9 9 Mutations u Bases ATCG u Séquence normale u CCCTTTTAAAGTGTGTCCCAAAA u Séquence mutée u CCCTTTTAAAGTGAGTCCCAAAA u Protéine ne fonctionne plus...

10 10 En résumé u 46 chromosomes u gènes u Plus de 1000 gènes par chromosomes u Pas la même résolution u Étude des chromosomes (caryotype) u Recherche de maladie génétique

11 11 Impact des maladies génétiques u Individus atteints u Malformation majeure pour 2-3% de chaque grossesse (doù surveillance échographique en France) u Fentes labiales ou labiopalatines 1/600 u Malformation cardiaque1/250 u Défaut de fermeture du tube neural1/500 u Anomalies chromosomiques 0.7% u Majorée par l âge maternel u Majorité denfants « normaux » !!, 96,3%

12 12 Fardeau génétique u Nous sommes tous des hétérozygotes !! u Porteurs sains dune ou plusieurs mutations u Selon les publications u 1,4 à 4-5 gènes mutés par individu u Maladies rares 1/100 u 1/25 mucoviscidose u 1/7 à 1/5 pour la Fièvre Méditerranéenne (Sous-groupe) u Risque pour la descendance estimé à 1% (toutes maladies génétiques confondues) u Éradiquer les mutations ? impossible...

13 13 Hérédité récessive u Deux parents hétérozygotes sains u Un gène normal, un gène muté u Transmission des deux gènes mutés à un enfant sur 4 u Homozygote malade

14 14 Hérédité récessive

15 15 Hérédité récessive

16 16 Hérédité récessive

17 17 Exemples de maladies récessives - Mucoviscidose - Drépanocytose - Hyperplasie congénitale des surrénales - Phénylcétonurie

18 18 Histoire clinique

19 19 ATCD familiaux

20 20 Exemple : Mucoviscidose u Maladie génétique fréquente u Récessive u 1/2500 naissances u 1/25 hétérozygotes u Maladie respiratoire et digestive u Gène CFTR u Chromosome 7, bras court, 27 Exons

21 21 Affection génétique à transmission Autosomique récessive 1 enfant atteint sur 2500 naissances porteur hétérozygote: 1 individu sur 25 fréquence variable selon les populations: Bretagne celtique: 1/1600 population d'Afrique du Nord: rare population asiatique: exceptionnel Mucoviscidose

22 22 5'3' a 6b a 14b a 17b COOH NBF2 NBF1domaine R N C Domaine extracellulaire Membrane plasmique Cytoplasme NH2 domaines NBF1 Domaine R domaines NBF2 transmembranaires transmembranaires CFTR glycoprotéine transmembranaire

23 23 MUCOVISCIDOSE Enquête en France: 19 laboratoires: 3595 patients 7190 allèles 6700 allèles mutés identifiés 300 mutations différentes (93,2%) F508: 67,21% (Bretagne 81%, Nord 70%, Sud: 61%) G542X: 2,89% N1303K: 2,05% G->A:,3,13% G->A: 1% 19 mutations: entre 0,1 et 1% 153 mutations ne sont retrouvées qu'une seule fois HETEROGENEITE ALLELIQUE

24 24 Arbre généalogique ATCD mucoviscidose Enfant atteint de mucoviscidose Hétérozygotes obligatoires 1/2 1/4 1/81/25 1/8x1/25x1/4 = 1/800

25 25 Modes de révélation u Prénatal u Hyper-échogénéicité du grêle u 1% (chromosomique, viral, vasculaire, mucov) u Péritonite méconiale u Absence de vésicule bilaire u Néonatal u Occlusion néonatale par iléus méconial

26 26 Adresser en consultation de génétique u Déterminer risque ou non u Etude génétique proposée u Mutations connues ou non u 31 mutations les plus fréquentes u Couvre 80% des mutations (4/5) u Surveillance de grossesse u Etude des deux parents u Reste une incertitude faible u Risque résiduel 1/500 (1/125 x 1/4)

27 27 Arbre généalogique ATCD mucoviscidose 1/125 1 x 1/125 x 1/4 = 1/500 ?

28 28 Arbre généalogique Hémochromatose Malade hémochromatose (1/400) 1/21/10 1/2x1/10x1/4 = 1/80

29 29 Maladie récessive u Pas de DPN u Diagnostic clinique u Ferritine u Dépistage des hétérozygotes ?? u Non, sauf conseil génétique

30 30 Hérédité dominante u Critères de reconnaissance, u une personne atteinte, transmet à un enfant sur 2

31 31 Hérédité dominante

32 32 Hérédité dominante

33 33 Exemples de maladies dominantes - Syndrome de Marfan - Hypochondroplasie - Maladie de Stickler

34 34 Hérédité Mendélienne u Autosomique dominante u Autosomique Récessive u Dominante liée à lX u Récessive liée à lX u Holandrique (liée à lY)

35 35 Conductrice obligatoire u Par définition u Un frère et une fils atteints u Deux fils atteints u Par extension Un fils atteint ET une fille conductrice obligatoire

36 36 Transmission Récessive liée à l X Notion de conductrice obligatoire M >>> F Pas de transmission Père-Fils Transmission verticale

37 37 Hérédité liée à l X - Garçons atteints !!!!! u 50 % des garçons atteints u 50 % des filles conductrices

38 38 Hérédité liée à l X XYXX XY XX XY

39 39 Hérédité lié à l X

40 40 Hérédité liée à l X - Hémophilie - Daltonisme - Myopathie de Duchenne de Boulogne

41 41 u 3 types de transmissions liées à l X u Dominant lié à l X létal chez le garçon u dominant lié à l X avec paradoxe de Sherman u Récessif lié à l X u Transmission en général par les filles si récessif u Transmission par les pères si dominant non létal u Jamais de transmission PèreFils Hérédité Liée à l X (1)

42 42 u Incontinentia pigmenti u Mutation du gène NEMO (Xq28) Hérédité DLX (2)

43 43 u Syndrome de l X fragile u Amplification de triplet CGG (Xq28) u Conseil génétique difficile Hérédité DLX (3) 100 CGG Pré mutation

44 44 u Myopathie de Duchenne de Boulogne 1/3500 u Mutations dans le gène de la Dystrophine (Xp21) Hérédité RLX (4)

45 45 Cas des filles atteintes u Monosomie X u Biais dinactivation u Mutation sur lallèle homologue

46 46 Conseil génétique u 50 % des garçons atteints u 50 % des filles conductrices u Pour les apparentés : risque modulé en fonction de la probabilité pour la mère dêtre conductrice (Bayes, étude moléculaire)

47 47 Exemple : Syndrome de lX fragile u Naissance de Baptiste u Troubles précoces de la relation mère-enfant u Inquiétude parentale ++ > 9 mois u Retard de marche u Pas de langage à 21 mois u Naissance d Alexis u Troubles précoces de la relation mère-enfant...

48 48

49 49 u Beaux garçons u Grand front u Grand PC u + 1 DS à + 3 DS u A la naissance, grand PC (35cm, 36cm, 37cm) u Trouble du contactAngoisse parentale u Stéréotypies u Évitement du regard u Pas de langage Clinique

50 50 Génétique X fragile u Gène FMR1 u Chromosome X u Cassure de lextrémité q28 u Expansion de triplets u Pré-mutation u Mutation complète u Retard mental et traits psychotiques du garçon u Retard plus modéré chez la fille

51 51

52 52 Mécanisme génétique u Expansion instable u Triplet CGG, dans le premier exon, non traduit, du gène FMR1 u Polymorphique u 6 à 50 répétitions + AGG (séquence impure) u Mutations complètes = 230 à > 1000 CGG, méthylation anormale u 100% RM garçon, 60% RM chez les filles u Prémutations = 60 à 200 CGG, non méthylés u Males normaux transmetteurs, femmes vectrices u Fréquence des mosaïques somatiques

53 53 Prénatal u Depuis lélucidation moléculaire, possible u Ponction de trophoblastes à 11 SA u PCR u Allèles normaux et petites prémutations u Southern blot u Analyse lADN u Taille des fragments u Méthylation

54 54 Dépistage précoce X fra u Éviter les récurrences u DPN u Prise en charge précoce en CAMPS u Lutter contre lenfermement psychotique u Guidance parentale

55 55 DYSTROPHIE MUSCULAIRE DE DUCHENNE (DMD) Fréquence: 1/3500 garçon né vivant quelque soit la population Transmission: récessive liée à lX Physiopathologie:dégénérescence lente et inéluctable des fibres musculaires (1860)

56 56 DYSTROPHIE MUSCULAIRE DE BECKER (BMD) Fréquence: 1/35000 garçon né vivant Transmission: récessive liée à lX Forme plus tardive et dévolution plus lente; elle ne devient invalidante quau cours de la vie adulte Variation allélique et hétérogéneité clinique: DMD et BMD: 2 variantes phénotypiques dune pathologie affectant un seul et même gène. (1955)

57 57 LE GENE Séquencé en 1987 Un très grand gène: - longueur: 2,4 Mb - 79 exons: taille moyenne des exons 180 pb taille moyenne des introns 30 kb Code pour une proteine: la Dystrophine (1988) acides aminés kDaltons

58 58

59 59

60 60 Mme M. demande un Conseil Génétique Elle a 2 fils: Paul (10 ans) et Léo (8 ans) et une fille (6 ans). Léo présente des difficultés à la marche (chutes). Le diagnostic de myopathie de Duchenne évoqué cliniquement a été confirmé par la biopsie musculaire. Mme M LéoPaul Définition Traitement - Gravité Mode de transmission Gène – Mutation(s) DPN Lydie

61 61 Mme M 3 DCD Recherche d antécédents familiaux LéoPaul à 9 ans Myopathie? Lydie

62 62 Conseil génétique au terme de la consultation - risque génétique ? Risque pour Mme M: conductrice ou non? Risque pour Paul ? Risque pour Lydie ? - Conduite à Tenir Discussion du risque génétique Analyse moléculaire pour Léo: diagnostic direct+++ Analyse moléculaire pour ? information de la famille maternelle

63 63 Léo Témoin normal

64 64 Léo Témoin normal Délétion 3 -> 43

65 65 3 DCD à 9 ans Myopathie? LéoPaul Lydie Mme M. Résultats de biologie moléculaire Conduite à tenir? Délétion 3->43

66 66 ? ? ? 3 DCD à 9 ans Myopathie? LéoPaul Lydie Délétion 3->43 Hier, appréciation du statut de conductrice par diagnostic indirect Aujourdhui, évaluation du statut de conductrice par diagnostic direct ?

67 67 ? ? ? ? LéoPaul Lydie Mme D. Diagnostic indirect: étude familiale, polymorphisme. S50 S49 S45 S44 Ex17 Dys II del del 2 Mme M. Mme A. Conductrice ou non? Mme D? Mme M? Mme F? Mme A? Mme F. ?

68 68 N d N N LéoPaul Lydie Mme D. S50 S49 S45 S44 Ex17 Dys II del del 2 Mme M. Mme A Mme F. ? Diagnostic direct: PCR quantitative: S44 et Ex17 Mme M. est conductrice: néomutation survenue chez elle

69 69 Mme D. et son mari vous consultent. Ce couple envisage une grossesse et s inquiète en raison d ATCD de myopathie de Duchenne dans la famille de Mme D.: chez son frère et chez un oncle décédé à l âge de 15 ans Conduite à tenir? Mme D.Léon

70 70 Forme familiale de Myopathie de Duchenne Mme D. a 50% de risque d être conductrice Analyse moléculaire: - recherche dune délétion dans le gène DMD chez Léon: PCR multiplex - prévoir les prélèvements familiaux pour étude indirecte le cas échéant

71 71 Pas de délétion CA TG15 S50 S49 S45 S44 Ex17 TG21 Dys II Conductrice ou non? III2? II4? II III

72 72 Conductrice ou non? II4?Non Conductrice Pas de DPN ?! III2? Pas de réponse: RECOMBINAISON Pas de délétion CA TG15 S50 S49 S45 S44 Ex17 TG21 Dys II II III

73 73 Etant donné la recombinaison intra génique retrouvée chez III2, le statut de conductrice ou non conductrice reste incertain Un diagnostic direct (recherche de mutation ponctuelle) doit être envisagé chez le cas index: Léon (III3) Après plusieurs mois de recherche: mise en évidence d une mutation ponctuelle dans l exon 45 (mutation non sens introduisant un codon stop)

74 74 M+ CA TG15 S50 S49 S45 S44 Ex17 TG21 Dys II II III M+ Conductrice ou non? II4?Non Conductrice Pas de DPN III2? Conductrice DPN possible N

75 75 34 HÉRÉDITÉ MITOCHONDRIALE Les maladies mitochondriales résultent de défauts au niveau des mitochondries (présentes dans toutes les cellules du corps à lexception des globules rouges). Les cellules les plus affectées sont celles du cerveau, du cœur, du foie, des muscles, du rein et du système respiratoire (les tissus ayant le plus grand besoin énergétique). En fonction des cellules qui sont affectées, les symptômes peuvent être très différents.

76 76 35 Hérédité Mitochondriale Les mitochondries sont exclusivement dorigine maternelle. Si lensemble des mitochondries dune cellule sont anormales, on parle dhomoplasmie. Si seules quelques mitochondries sont anormales dans une cellule, on parlera dhétéroplasmie. Lâge de déclenchement de la pathologie, sa sévérité et les symptômes observés dépendent du pourcentage de mitochondries anormales dans un tissu donné.

77 77 Hérédité mitochondriale

78 78

79 79

80 80

81 81 Conseil génétique en pratique

82 82

83 83

84 84 Consultations de génétique u Interrogatoire u Généalogie u Examen Clinique u Photographies avec le consentement des patients u Examens Complémentaires

85 85 Consanguinité

86 86 36 A B D C E F G

87 87 37 AD AR DLX RLX LY Mito

88 88 Hérédité Chromosomique Analyse dysmorphologique

89 89

90 90 Microdélétion EX: Syndrome de Williams u Mathieu u 1 an u Retard discret des acquisitions u Cardiopathie u Sténose supravalvulaire de l aorte u Sténose Artère pulmonaire u Hypercalcémie néonatale u Dysmorphie spécifique

91 91 Génétique du syndrome de Williams u Hérédité u Sporadique u Rare dominance u Locus génétique u Chromosome 7 u Microdélétion 7q11 u Hémizygotie au locus Elastine u Délétions u Autres gènes de la région: LIM Kinase 1 …..

92 92

93 93 Syndromes acquis Syndrome de lalcoolisme fœtal

94 94 Autres « maladies héritées », non génétiques u Syndrome dAlcoolisme fœtal u Sous-diagnostiqué u 10 à 20% des QI ? u 1/1000 naissances en France u Tableau malformatif u RCIU précoce u Malformations possibles u CIV, CIA u Fentes labiales ou labiopalatines

95 95 Présentation clinique u RCIU avec PC non conservé u Dysmorphie faciale u Philtrum long, lisse et bombé u Fentes palpébrales étroites … u Malformations u Hypoplasie des phalanges distales u CIA, CIV, fentes faciales


Télécharger ppt "1 Génétique Cours 1 DCEM1 Brigitte Benzacken ; Cytogénétique GHU Nord Marion Gérard ; Génétique Robert Debré Bénédicte Gérard; Biologie Moléculaire RDebré"

Présentations similaires


Annonces Google