La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Snail / schistosome compatibility Réunion Scientifique mardi 3 Avril 2007 André THERON UMR 5244 BIOLOGIE ET ECOLOGIE TROPICALE ET MEDITERRANEENNE University.

Présentations similaires


Présentation au sujet: "Snail / schistosome compatibility Réunion Scientifique mardi 3 Avril 2007 André THERON UMR 5244 BIOLOGIE ET ECOLOGIE TROPICALE ET MEDITERRANEENNE University."— Transcription de la présentation:

1 Snail / schistosome compatibility Réunion Scientifique mardi 3 Avril 2007 André THERON UMR 5244 BIOLOGIE ET ECOLOGIE TROPICALE ET MEDITERRANEENNE University of Perpignan Perpignan - France from populations to mechanisms

2 Mollusc / Trematode models Trematode life cycles Schistosoma mansoni Biomphalaria glabrata

3 Mollusc / Trematode models Adults Egg Miracidium Cercariae Schistosome life cycle Schistosoma mansoni Biomphalaria glabrata

4 rainy season Snail infection in Field populations dry season The typically low Infection rates Most of the field surveys on natural populations of Biomphalaria snails report : (1-5%) variations of population size high mortality rates genetic bottleneck (extinction / recolonisation, founder effect)

5 Ecologie moléculaire de la transmission : recrutement et diversité génétique Théron et al., Parasitology. Génotypage intra-hôte : - parasites adultes HD (microsatellites) - Parasite larvaires HI (microsatellites) 1%100% ? 12 Limited contact RESISTANT/ SUSCEPTIBLE

6 HOST RESISTANT HOST Resistance / Susceptibility Polymorphism of host susceptibility/resistance Laboratory strains Experimental infections % 2 0 % 50 % 100 % nMi selected «SUSCEPTIBLE» strain Selected «RESISTANT» strain

7 … Evolutionary inferences (Co-evolution, Life history and Red Queen theories, …) Fitness Cost associated with resistance (Webster & Woolhouse, 2001 ). Mating behaviour associated with resistance (Webster et al., 2003 ). Molecular markers associated with resistance (Spada et al., 2002 ). EVOLUTIONARY IMPLICATIONS >> Maintenance of resistance/susceptibility polymorphism Resistance is heritable and dominant (Richards et al., 1992 ). Routinely used to investigate : -host defence mechanisms -Genetics of resistance -Genes of resistance 2 Selected Resistantstrains: selected «RESISTANT» strain trade-offs between the FITNESS COST associated with RESISTANCE (reduced fertility) and the fitness costs resulting from parasitism (increased mortality). (Webster & Davis, Parasitology, 123, 2001)

8 Laboratory selected resistantstrains: use and limitation. However, despite extensive efforts and use of various complementary biomolecular approaches, no linkage group, no genetic or functional marker has been assigned to any locus controlling resistance. Théron & Coustau (J. Helminthol., 2005) raised the question : Are Biomphalaria snails RESISTANT to Schistosoma mansoni ? based on some arguments …

9 B. glabrata resistance : a relative concept Developed sporocyst SUSCEPTIBLE HOST Encapsulated sporocysts SUCCESSFUL INFECTION FAILURE of INFECTION RESISTANT HOST

10 Compatibility is tested independently for each entering miracidium. We conclude that … The phenotype (resistant vs susceptible) of the host is expressed as a function of the parasite genotype it harbors. The phenotype (un-infective vs infective) of the parasite is expressed as a function of the host genotype it enters. This means that the CONCEPT of RESISTANCE (and its evolutionary implication) appears un-adapted to the B. glabrata / S. mansoni system

11 … Evolutionary inferences (co-evolution, life history and Red Queen theories, …) Molecular markers associated with resistance Fitness Cost associated with resistance Mating behaviour associated with resistance Resistant selected (Webster & Woolhouse, 2001 ). (Webster et al., 2003 ). (Spada et al., 2002 ). EVOLUTIONARY IMPLICATIONS >> Resistance is heritable and dominant (Richards et al., 1992 ). 2 Selected Resistantstrains: Apparent Resistance Warning

12 Resistance / Infectivity in Field populations Going back to the field ……, 2 RESISTANT/ SUSCEPTIBLE Genotype-by-genotype Interaction 3 GENETICDIVERSITYGENETICDIVERSITY Compatible Un-Compatible Polymorphism of compatibility

13 Genotype-by-Genotype interaction Matching genotype Parasite genotypic diversity Snail genotypic diversity Compatibility polymorphism and B. glabrata « resistance » in the field ? %

14 0 % 50 % 100 % nMi - exposed snails directly collected in the site - S. mansoni eggs obtained from a substantial number of naturally infected vertebrate hosts - increasing miracidial dose exposures Populational validation Dans Fond Dubelloy Belle Plaine 100 % compatibility

15 Among Biomphalaria and S. mansoni associations, susceptibility of snails in the field is general if we take into account the total amount of genetic diversity present within the whole population of parasites within vertebrate hosts. Snail genetic diversity Parasite genetic diversity Field situation 100 % matching We conclude that … Meeting probability 1-5% infection rates + Matching probability

16 Snail genetic diversity Parasite genetic diversity Field situation 100 % matching Apparent resistance in Laboratory strains … Laboratory Strains 0 à 60 % matching

17 The functional point of view : Schistosomes use molecular mimicry as infectivity strategy and are confronted to self/non-self recognition processes of the host (general immune defence) success Matched Molecular Variants failure Un-Matched Molecular Variant A genetically determined mechanism theoretically consistent with a matching genotype model Host Parasite

18 CONCLUSION … Matched vs Un-matched status of host-parasite combinations : ? What phenotypic factors interact between host and parasite ? What genomic mechanisms generate diversity ? from populations to mechanisms (André THERON) from mechanisms to populations (Guillaume MITTA)

19 Biomphalaria glabrata Schistosoma mansoni Incompatible Compatible Recherche des gènes acteurs de la compatibilité: Approches moléculaires comparatives entre souches de S. mansoni Sporocyste I installé chez le mollusque Sporocyste I en dégénérescence Capsule hémocytaire

20 Approche protéomique comparative et identification de candidats prometteurs, les MSPPs Mw pI (NL) Mw pI (NL) 3 10 Parasites compatiblesParasites incompatibles Mother Sporocyst Polymorphic Proteins (MSPPs) répétitions de 9 aa en tandem 234 aa Etc.. analogies de structure pour des protéines immuno- dominantes de Plasmodium et Coccidioides : rôle «écran de fumée» O-glycosylations

21 Les MSPPs et les variants au niveau cDNA REPET B:GGTGACCTCGCATCAGACAAACCCACA B G D L A S D K P T REPET BMOD: GGTGGCCTCGCATCAGACAAACCCACA B G G L A S D K P T REPET G: GATGACTATGCATTGAGCGAACCAACA G D D Y A L S E P T REPET GMOD: GATTACTATGCATTGAGCGAACCAACA G D Y Y A L S E P T REPET M:GGTGACCTCGCATTAGACGAACCAACA M G D L A L D E P T Compatible Incompatible BBBBBBBBBBBBBBBBBBBBBBBBBB BBBBBBBBBBBBBBBBBBBB BBBBBB BBBBBBBBBBB BBBBBBBBBBBBBBB BBBBB GGGGGGGGGGG GGGGGGGGG GGGG GGG GG BBBBBB BBBBBBBB GGGGGGGGGGG GGGGGGGG GGGGG GG GGMGG GGBBBBBBBBBBB GGBBGG GGBBG GGBBBBG

22 Les MSPPs: ume famille multigénique MSPP1a MSPP2a MSPP MSPP6 MSPP MSPP1b * 1415 MSPP2b MSPP MSPP MSPP MSPP gènes 8 pseudogènes Retrotransposons (RT) Gènes soumis à des insertions, remaniements fréquents médiés par ces RT exons

23 - Protéines potentiellement impliquées dans le contournement du système de défense de B. glabrata par S. mansoni - Polymorphisme et organisation génomique génératrice de diversité Le modèle B. glabrata/S. mansoni: les MSPPs des candidats de choix Candidats de choix en tant que facteurs clefs de la compatibilité Candidats pour une 1 ère « approche populationnelle »

24 Comparaison des MSPPs: Protéines « actrices » de la compatibilité en populations naturelles? Compatible Compatibles Pop Nat Labo Guadeloupe Brésil Isolats de S. mansoni de Guadeloupe 4% 6% Polymorphisme de compatibilité et MSPPs en populations naturelles


Télécharger ppt "Snail / schistosome compatibility Réunion Scientifique mardi 3 Avril 2007 André THERON UMR 5244 BIOLOGIE ET ECOLOGIE TROPICALE ET MEDITERRANEENNE University."

Présentations similaires


Annonces Google