La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Mk2006-2007 Design des amorces Recherche et optimisation des amorces pour la PCR Les amorces doivent être spécifiques, stables et compatibles Etape cruciale.

Présentations similaires


Présentation au sujet: "Mk2006-2007 Design des amorces Recherche et optimisation des amorces pour la PCR Les amorces doivent être spécifiques, stables et compatibles Etape cruciale."— Transcription de la présentation:

1 mk Design des amorces Recherche et optimisation des amorces pour la PCR Les amorces doivent être spécifiques, stables et compatibles Etape cruciale de la réussite de la PCR

2 mk Design des amorces Amorce gauche et amorce droite Peut être déterminé à laide de SMS2 Sequence Manipulation Suite 2

3 mk Design des amorces Zone dhybridation unique Lamorce doit shybrider avec une seule zone de lADN matrice 5-TGATACATCGCCGTCGTCGT……………………CGACATCGCCGTCGTACCCGTCGTCCGTCGGG-3 Amorce spécifique Amorce non spécifique Il est nécessaire détablir la carte dhybridation des amorces avec lADN matrice Résultat obtenu avec Sequence Manipulation Suite 2Sequence Manipulation Suite 2 EXEMPLE |||||||||||| 5-CGACGGACGACG-3 5-CGACGGCGATGT-3 |||||||||||| 5-CGACGGCGATGT-3 ||||||||||||

4 mk Design des amorces Spécificité de lamorce Lamorce doit être spécifique du gène ou de lespèce recherchée. Elle ne doit pas shybrider avec un ADN contaminant Pour le vérifier on peut réaliser un alignement local avec BLAST 5-GTGAAATTATCGCCACGTTCGGGCAA-3 Amorce gauche utilisée pour détecter Salmonella sp *Letters in Applied Microbiology 2003, 36, 217–221 EXEMPLE

5 mk Design des amorces Longueur des amorces La longueur de lamorce influe sur la température de fusion (Tm), la température dhybridation (Ta) et la spécificité En général nucléotides Spécificité et Tm augmentent avec la longueur

6 mk Design des amorces Composition des amorces La composition en bases de lamorce influe sur la température de fusion (Tm), la température dhybridation (Ta) et la spécificité En général compris entre 40-60% La Tm augmente avec le %GC Il faut éviter les zones riches en AT ou en CG, la répartition des bases doit être de préférence aléatoire

7 mk Design des amorces Détermination du Tm et Ta Tm = 4. (nG + mC) + 2. (pA + qT) Tm = 81,5 + 16,6. Log([M + ]) + 0,41. (%GC) – 675 / L Règle de Wallace Règle tenant compte de la longueur et les sels monovalents (M) Méthode thermodynamique (nearest-neighbour base model) Ta = 0,3. Tm(amorce) + 0,7. Tm(amplicon) - 14,9 Melting temperature Annealing temperature Liens pour détermination Tm par différentes méthodes Méthode la plus précise car elle tient compte de la séquence (forces dempilement des bases) et pas uniquement du %GC

8 mk Design des amorces Stabilité de lextrémité 3 La stabilité de lextrémité 3 conditionne une bonne initiation de la polymérisation Extrémité 3 stableExtrémité 3 instable On privilégie la présence de quelques bases GC en 3, mais pas en grand nombre car on risque de provoquer des fixations non spécifiques 5-TGATACATCGCCGTCGTCGT……………………CGACATCGCTCGTCCGTCGGTCGTCCGTCGGG-3 5-CGACGGACGAGCG-3 ||||||||||||| GCG-3 ||| 5-CGACGGACGA False priming

9 mk Design des amorces Dimères et épingles à cheveux Les amorces ne doivent pas sautohybrider (self-dimer) ni shybrider entre elles (dimer), ni former des structures en épingles à cheveux (hairpin) La stabilité de ces structures est évaluée par le G. Liens pour analyser les primers (Netprimer)

10 mk Design des amorces Compatibilité des amorces Les amorces doivent avoir des Ta proches et par conséquent des Tm proches La différence des Ta ne doit pas excéder 2 à 3 °C

11 mk Design des amorces Exercice Recherche du gène invA de Salmonella typhimurium dans GENBANK Recherche damorces simples et vérification de leur qualité Recherche damorces optimisées avec Primer3 Recherche damorces optimisées avec PerlPrimer

12 mk Design des amorces Recherche du gène invA de Salmonella typhimurium

13 mk Design des amorces Résultats

14 mk Design des amorces Séquence du gène invA de Salmonella typhimurium Séquence du gène au format FASTA >gi|154154|gb|M |STYINVA Salmonella typhimurium InvA (invA) GATATTGCCTACAAGCATGAAATGGCAGAACAGCGTCGTACTATTGAAAAGCTGTCTTAATTTAATATTA ACAGGATACCTATAGTGCTGCTTTCTCTACTTAACAGTGCTCGTTTACGACCTGAATTACTGATTCTGGT ACTAATGGTGATGATCATTTCTATGTTCGTCATTCCATTACCTACCTATCTGGTTGATTTCCTGATCGCA CTGAATATCGTACTGGCGATATTGGTGTTTATGGGGTCGTTCTACATTGACAGAATCCTCAGTTTTTCAA CGTTTCCTGCGGTACTGTTAATTACCACGCTCTTTCGTCTGGCATTATCGATCAGTACCAGTCGTCTTAT CTTGATTGAAGCCGATGCCGGTGAAATTATCGCCACGTTCGGGCAATTCGTTATTGGCGATAGCCTGGCG GTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTG TCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTT GAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGAACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTT TACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTG TGAACTTTATTGGCGGTATTTCGGTGGGGATGACTCGCCATGGTATGGATTTGTCCTCCGCCCTGTCTAC TTATACCATGCTGACCATTGGTGATGGTCTTGTCGCCCAGATCCCCGCATTGTTGATTGCGATTAGTGCC GGTTTTATCGTGACCCGCGTAAATGGCGATACGGATAATATGGGGCGGAATATCATGACGCAGCTGTTGA ACAACCCATTTGTATTGGTTGTTACGGCTATTTTGACCATTTCAATGGGAACTCTGCCGGGATTCCCACT GCCGGTTTTTGTTATTTTATCGGTGGTTTTAAGCGTACTCTTCTATTTTAAATTCCGTGAAGCAAAACGT AGCGCCGCCAAACCTAAAACCAGCAAAGGCGAGCAGCCGCTCAGTATTGAGGAAAAAGAAGGGTCGTCGT TAGGACTGATTGGCGATCTCGATAAAGTCTCTACAGAGACCGTACCGTTGATATTACTTGTGCCGAAGAG CCGGCGTGAAGATCTGGAAAAAGCTCAACTTGCGGAGCGTCTACGTAGTCAGTTCTTTATTGATTATGGC GTGCGCCTGCCGGAAGTATTGTTACGAGATGGCGAGGGCCTGGACGATAACAGCATCGTATTGTTGATTA ATGAGATCCGTGTTGAACAATTTACGGTCTATTTTGATTTGATGCGAGTGGTAAATTATTCCGATGAAGT CGTGTCCTTTGGTATTAATCCAACAATCCATCAGCAAGGTAGCAGTCAGTATTTCTGGGTAACGCATGAA GAGGGGGAGAAACTCCGGGAGCTTGGCTATGTGTTGCGGAACGCGCTTGATGAGCTTTACCACTGTCTGG CGGTGACCGTGGCGCGCAACGTCAATGAATATTTCGGTATTCAGGAAACAAAACATATGCTGGACCAACT GGAAGCGAAATTTCCTGATTTACTTAAAGAAGTGCTCAGACATGCCACGGTACAACGTATATCTGAAGTT TTGCAGCGTTTGTTAAGCGAACGTGTTTCCGTGCGTAATATGAAGTTAATTATGGAAGCGCTCGCATTGT GGGCGCCAAGAGAAAAAGATGTCATTAACCTTGTGGAGCATATTCGTGGAGCAATGGCGCGTTATATTTG TCATAAATTCGCCAATGGCGGCGAATTACGAGCAGTAATGGTATCTGCTGAAGTTGAGGATGTTATTCGC AAAGGGATCCGTCAGACCTCTGGCAGTACCTTCCTCAGCCTTGACCCGGAAGCCTCCGCTAATTTGATGG ATCTCATTACACTTAAGTTGGATGATTTATTGATTGCACATAAAGATCTTGTCCTCCTTACGTCTGTCGA TGTCCGTCGATTTATTAAGAAAATGATTGAAGGTCGTTTTCCGGATCTGGAGGTTTTATCTTTCGGTGAG ATAGCAGATAGCAAGTCAGTGAATGTTATAAAAACAATATAAGGGCTTAATTAAGGAAAAGATCTATGCA ACATTT Séquence cible à amplifier (300 nt)

15 mk Design des amorces Amorces non optimisées >gi|154154|gb|M |STYINVA Salmonella typhimurium InvA (invA) GATATTGCCTACAAGCATGAAATGGCAGAACAGCGTCGTACTATTGAAAAGCTGTCTTAATTTAATATTA ACAGGATACCTATAGTGCTGCTTTCTCTACTTAACAGTGCTCGTTTACGACCTGAATTACTGATTCTGGT ACTAATGGTGATGATCATTTCTATGTTCGTCATTCCATTACCTACCTATCTGGTTGATTTCCTGATCGCA CTGAATATCGTACTGGCGATATTGGTGTTTATGGGGTCGTTCTACATTGACAGAATCCTCAGTTTTTCAA CGTTTCCTGCGGTACTGTTAATTACCACGCTCTTTCGTCTGGCATTATCGATCAGTACCAGTCGTCTTAT CTTGATTGAAGCCGATGCCGGTGAAATTATCGCCACGTTCGGGCAATTCGTTATTGGCGATAGCCTGGCG GTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTG TCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTT GAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGAACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTT TACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTG TGAACTTTATTGGCGGTATTTCGGTGGGGATGACTCGCCATGGTATGGATTTGTCCTCCGCCCTGTCTAC TTATACCATGCTGACCATTGGTGATGGTCTTGTCGCCCAGATCCCCGCATTGTTGATTGCGATTAGTGCC GGTTTTATCGTGACCCGCGTAAATGGCGATACGGATAATATGGGGCGGAATATCATGACGCAGCTGTTGA ACAACCCATTTGTATTGGTTGTTACGGCTATTTTGACCATTTCAATGGGAACTCTGCCGGGATTCCCACT GCCGGTTTTTGTTATTTTATCGGTGGTTTTAAGCGTACTCTTCTATTTTAAATTCCGTGAAGCAAAACGT AGCGCCGCCAAACCTAAAACCAGCAAAGGCGAGCAGCCGCTCAGTATTGAGGAAAAAGAAGGGTCGTCGT TAGGACTGATTGGCGATCTCGATAAAGTCTCTACAGAGACCGTACCGTTGATATTACTTGTGCCGAAGAG CCGGCGTGAAGATCTGGAAAAAGCTCAACTTGCGGAGCGTCTACGTAGTCAGTTCTTTATTGATTATGGC GTGCGCCTGCCGGAAGTATTGTTACGAGATGGCGAGGGCCTGGACGATAACAGCATCGTATTGTTGATTA ATGAGATCCGTGTTGAACAATTTACGGTCTATTTTGATTTGATGCGAGTGGTAAATTATTCCGATGAAGT CGTGTCCTTTGGTATTAATCCAACAATCCATCAGCAAGGTAGCAGTCAGTATTTCTGGGTAACGCATGAA GAGGGGGAGAAACTCCGGGAGCTTGGCTATGTGTTGCGGAACGCGCTTGATGAGCTTTACCACTGTCTGG CGGTGACCGTGGCGCGCAACGTCAATGAATATTTCGGTATTCAGGAAACAAAACATATGCTGGACCAACT GGAAGCGAAATTTCCTGATTTACTTAAAGAAGTGCTCAGACATGCCACGGTACAACGTATATCTGAAGTT TTGCAGCGTTTGTTAAGCGAACGTGTTTCCGTGCGTAATATGAAGTTAATTATGGAAGCGCTCGCATTGT GGGCGCCAAGAGAAAAAGATGTCATTAACCTTGTGGAGCATATTCGTGGAGCAATGGCGCGTTATATTTG TCATAAATTCGCCAATGGCGGCGAATTACGAGCAGTAATGGTATCTGCTGAAGTTGAGGATGTTATTCGC AAAGGGATCCGTCAGACCTCTGGCAGTACCTTCCTCAGCCTTGACCCGGAAGCCTCCGCTAATTTGATGG ATCTCATTACACTTAAGTTGGATGATTTATTGATTGCACATAAAGATCTTGTCCTCCTTACGTCTGTCGA TGTCCGTCGATTTATTAAGAAAATGATTGAAGGTCGTTTTCCGGATCTGGAGGTTTTATCTTTCGGTGAG ATAGCAGATAGCAAGTCAGTGAATGTTATAAAAACAATATAAGGGCTTAATTAAGGAAAAGATCTATGCA ACATTT Amorces déduites des séquences en amont et en aval 5-TTATCGCCACGTTCGGGCAA-3 Amorce gauche 5-CCGCCAATAAAGTTCACAAA-3 Amorce droite

16 mk Design des amorces Analyse de lamorce gauche avec NetprimerNetprimer Mauvaise amorce : formation dépingle, de dimères

17 mk Design des amorces Analyse de lamorce droite avec Netprimer Pas dépingle, pas de dimères Mais Tm très différent de lamorce gauche

18 mk Design des amorces Recherche damorces avec Primer3Primer3

19 mk Design des amorces Résultats avec Primer3 Légende ****** cible >>>>>> amorce gauche <<<<<< amorce droite Plusieurs couples damorces sont proposés On remarque que le logiciel a trouvé dautres amorces plus optimisées mais pas à la même position

20 mk Design des amorces Recherche damorces avec PerlPrimer Il sagit dun logiciel libre téléchargeable Copier/coller la séquence Définir la région à amplifier Recherche des amorces Visualisation et analyse des amorces Visualisation de la séquence et des amorces

21 mk Design des amorces Résultats avec PerlPrimer On peut réaliser un Blast directement pour vérifier la spécificité des amorces Analyse de la qualité des amorces

22 mk Design des amorces Résultats de lanalyse avec Blast Les primers choisies salignenent en uniquement avec des séquences provenant de Salmonella


Télécharger ppt "Mk2006-2007 Design des amorces Recherche et optimisation des amorces pour la PCR Les amorces doivent être spécifiques, stables et compatibles Etape cruciale."

Présentations similaires


Annonces Google