RNA structure: tRNA Primary structure Secondary structure

Slides:

Advertisements

Présentations similaires

4 Avoir Les normes: –Communication 1.2 : Understanding the written and spoken language –Comparisons 4.1 : Understanding the language through making comparisons.

Advertisements

Algorithmes et structures de données avancés

TOUTES LES FORMES Two slides each set per one concept. Kathleen Pepin.

5 Contractions Les normes: Communication 1.1 – Understanding the spoken and written language Comparisons 4.1 – Understanding the nature of language through.

Knowledge about language Prepositions au, à la, à l In French, you must use one of the prepositions au, à la, à l after the structure je vais (the verb.

donner Click on one of the ten sounds. sound 1 sound 2 sound 3 sound 4 sound 5 sound 6 soundsspelling sound 7 sound 8 sound 9 sound 10 Exit.

GPA750 – Ordonnancement des systèmes de production aéronautique

Conception et analyse des algorithmes

Information Theory and Radar Waveform Design Mark R. bell September 1993 Sofia FENNI.

D.E ZEGOUR Ecole Supérieure d’Informatique

D.E ZEGOUR Ecole Supérieure d’Informatique

Séquençage par hybridation

Laboratoire des outils informatiques pour la conception et la production en mécanique (LICP) ÉCOLE POLYTECHNIQUE FÉDÉRALE DE LAUSANNE 1 Petri nets for.

Complexité des Problèmes Combinatoires Module IAD/RP/RO/Complexité Philippe Chrétienne.

3 Les Verbes -ER Talking about people’s activities Les normes: –Communication 1.2: Understanding the written and spoken language –Comparisons 4.1: Understanding.

Projet Comenius Roanne Etat Minister of Education Najat VALLAUD-BELKACEM Académie Rectrice ( 3 countries: Ain/Rhône/Loire) Mme MOULIN CIVIL Département.

FRANCE Coordinating Institute (partner signing the CA) CNRS-INSU National team description CNRS, CEA, BRGM, IFREMER, IRF, IRSN, IPGP, several universities.

Décomposition de graphes pour la reconstruction de réseaux phylogénétiques V. Berry (MAB) et C. Paul (VAG, HdR) Candidat AMN : Philippe Gambette (LIAFA)

Introduction Définir Planning. L’agent Planning. Représentation pour l’agent planning. Idées derrieres l’agent planning.

Structures de données et algorithmes – TP7 Maria-Iuliana Dascalu, PhD

NP-complétude de EDIT ( Nested, Nested ) G.Blin, G. Fertin, I. Rusu, C. Sinoquet Institut de Recherche en Informatique de Nantes.

Halloween By p6b. Explain Halloween is on the 31 st of October and is on the streets. Kids like to go and say “trick or treat”. − Halloween se passe le.

English Français

Travail # 1 Tutorial de mathematiques Foyer : 140

Clique Percolation Method (CPM)

Les normes: Communication 1.1 – Understanding the spoken and written language Comparisons 4.1 – Understanding the nature of language through comparisions.

1 Linear Prediction. 2 Linear Prediction (Introduction) : The object of linear prediction is to estimate the output sequence from a linear combination.

Les verbes en –er au présent The basic form of a verb is called the infinitive (l’infinitif)

BUSINESS PROCESS MANAGEMENT: PATTERNS AND BPM GROUPE 4 : - NITCHEU PAOLO - KENGMO VOUTSA MARLENE - TCHOUKOUA MARTIN - NGO’MBU M’BUMBE Ivel Olivia Sous.

Les ORMs ● Faire coexister le monde relationnel et objet.

Stage de Master M2 Les graphes 2-intervallaires Philippe Gambette Sous la direction de Michel Habib (LIAFA) LIAFAUniversité.

Deux facteurs: l’œuf et la poule Position théorique: décrire la langue au niveau de la performance Position théorique: décrire la langue au niveau de la.

IP Multicast Text available on

Exercice On considère un Système de contrôle de température composé de: Capteur, ordinateur Le capteur transmit à chaque heure de la journée la température.

IFT 702 – Planification en intelligence artificielle Langage PDDL

A Les verbes en -er: le singulier p. 94 The basic form of a verb is called the infinitive. Many French infinitives end in -er. Most of these verbs are.

French Two Grammar Two Part One

Sujet 1 : Wrapper stats sur les jeux de données ARN non codants

Qu’est-ce qu’ils aiment faire?

Relevés topographiques souterrains

Séminaire Capitalisation

Les Prépositions.

Cyber-Sphinx Séance 2.

Lionel Walter Information scientifique et bibliotheques (SISB)

Apprentissage profond Q

Albert Camus (1913 – 1960) was one of the pre-eminent writers of the twentieth century, winning the Nobel Prize in Literature in he was born in Algeria.

© 2004 Prentice-Hall, Inc.Chap 4-1 Basic Business Statistics (9 th Edition) Chapter 4 Basic Probability.

Data Driven Decision Making Workshop Sept , Kigali, Rwanda

A PCA-based feature extraction method for face recognition — Adaptively weighted sub-pattern PCA (Aw-SpPCA) Group members: Keren Tan Weiming Chen Rong.

Chapitre 7: Groupage.

Techniques du Data Mining

The consequences of the.

Lect12EEE 2021 Differential Equation Solutions of Transient Circuits Dr. Holbert March 3, 2008.

Des adjectifs irreguliers

SDRP & MA Problème du rendez vous : un algorithme probabiliste et une analyse probabiliste 09/11/2018.

Génération aléatoire de structures d’ARN réalistes

Talking about people’s activities

Problèmes fondamentaux de l’informatique

Generating Random Genomic Sequences and Structures with GenRGenS

Efficacité des algorithmes

IFT313 Introduction aux langages formels

Clonage Moléculaire.

Prédiction de structures secondaires d’ARN

Roots of a Polynomial: Root of a polynomial is the value of the independent variable at which the polynomial intersects the horizontal axis (the function.

Imperfect Subjunctive

Prepositions of location and disjunctive pronous

Prepositions of Location

Transcription de la présentation:

RNA structure: tRNA Primary structure Secondary structure GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAUAUCUGGAGGUCCUGUGUUCGAUCCCACAGAAUUCGCACCA Secondary structure Tertiary structure

RNA « Bio-Algorithmics » Structure prediction given one sequence or given a set of (homologous) sequences Design: sequence prediction (given structure) Structural pattern-matching Comparison of two or several structures

RNA structure levels  Arc-annotated sequences RNA structure ~ Graph of bounded degree, containing a (known) hamiltonian path.  Arc-annotated sequences Crossing (Secondary structure with pseudoknots) General (Tertiary structure) Plain (Primary structure) Nested (Secondary structure without pseudoknots)

The Chomsky Hierarchy Language Automaton Grammar Recognition Dependency Biology Recursively Enumerable Languages Turing Machine Unrestricted Baa  A Undecidable Arbitrary Unknown Context- Sensitive Languages Linear-Bounded Context-Sensitive At  aA NP-Complete Crossing Pseudoknots, etc. Context- Free Languages Pushdown (stack) Context-Free S  gSc Polynomial Nested Orthodox 2o Structure Regular Languages Finite-State Machine Regular A  cA Linear Strictly Local Central Dogma From D. Searls

Prédiction de structure d’ARN Séquence  Structure de plus faible énergie libre (selon un modèle d’énergie donné) GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAUAUCUGGAGGUCCUGUGUUCGAUCCCACAGAAUUCGCACCA

La prédiction de structure d’ARN est un problème NP-complet. Lyngso, Pedersen 2000

Que faire face à un pb NP-complet ? Chercher un algorithme exact fûté (mais sans garantie de temps) Chercher un algorithme d’approximation Chercher une heuristique d’approximation Contraindre les données du problème GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAUAUCUGGAGGUCCUGUGUUCGAUCCCACAGAAUUCGCACCA

Prédiction de structure: Nussinov (1978) sans pseudo-nœud, en maximisant le nombre de nucléotides appariés. γ(i,j) = nombre d’appariements dans la structure entre les ième et jème nucléotides. δ(i,j) = 1 si i et j sont appariables, 0 sinon.

Algorithme de Nussinov (1978) j i+1 j-1 i i+1 j j i j-1 2. 1. 3. i k k+1 j Les 4 façons possibles de construire la meilleure structure entre i et j, connaissant les meilleures sous-structures entre i+1 et j-1. 4.

Le plus utilisé : mfold (Zuker-Stiegler)

RNA « Bio-Algorithmics » Structure prediction given one sequence or given a set of (homologous) sequences Design: sequence prediction (given structure) Structural pattern-matching Comparison of two or several structures