Formation Bio-informatique Apimet 2013

Présentation au sujet: "Formation Bio-informatique Apimet 2013"— Transcription de la présentation:

1 Formation Bio-informatique Apimet 2013
Recherche et analyse de polymorphismes SNP Alexis Dereeper Formation Bio-informatique Apimet 2013

2 But du TP Short reads Solexa Connaître et manipuler des packages/outils disponibles pour la recherche de SNP et INDEL à partir de données NGS (assemblage de données NGS) Mapping SAM Variations alléliques Réfléchir sur les difficultés rencontrées liées aux nouvelles technologies de séquençage (différencier erreur de séquençage, paralogues et variation allélique) Liste de SNP A/G 1998 T/C 2341 T/G Détecter les SNP et pouvoir affecter les génotypes aux différentes positions polymorphes Assignation des génotypes Ind1 ATTGTGTCGTAACGTATGTCATGTCGT Ind2 ATTGTGTCGGAACGTATGTCATGTCGT Ind3 ATTGTGTCGKAACGTATGTCATGTCGT Exploiter simplement les données de polymorphismes via une application Web (diversité génétique, DL) Design de puces Illumina Obtenir un jeu de données exploitables à envoyer pour le design d’une puce SNP haut-débit (technologie Illumina VeraCode) Exploitation des données de polymorphismes

3 Formation Bio-informatique Apimet 2013
Tablet Outil graphique de visualisation d’assemblage de données NGS Accepte différents formats: ACE, SAM, BAM Alexis Dereeper Formation Bio-informatique Apimet 2013

4 Formation Bio-informatique Apimet 2013
GATK (Genome Analysis ToolKit) Librairie logicielle pour l'analyse de données NGS. Développé pour l'analyse des projets de reséquençage médical chez l'Humain (1000 Génomes, The Cancer Genome Atlas) Inclut des outils d'analyse de profondeur, recalibrateur de score de qualité, détection de SNP/InDel Complémentaire des 2 autres packages: SamTools, PicardTools PREPROCESS: * Index human genome (Picard), we used HG18 from UCSC. * Convert Illumina reads to Fastq format * Convert Illumina 1.6 read quality scores to standard Sanger scores FOR EACH SAMPLE: 1. Align samples to genome (BWA), generates SAI files. 2. Convert SAI to SAM (BWA) 3. Convert SAM to BAM binary format (SAM Tools) 4. Sort BAM (SAM Tools) 5. Index BAM (SAM Tools) 6. Identify target regions for realignment (Genome Analysis Toolkit) 7. Realign BAM to get better Indel calling (Genome Analysis Toolkit) 8. Reindex the realigned BAM (SAM Tools) 9. Call Indels (Genome Analysis Toolkit) 10. Call SNPs (Genome Analysis Toolkit) 11. View aligned reads in BAM/BAI (Integrated Genome Viewer) Alexis Dereeper Formation Bio-informatique Apimet 2013

5 Formation Bio-informatique Apimet 2013
Détection automatique de SNP à partir d’assemblage SAM Fastq Exemple de chaine de traitement réalisable avec Galaxy SouthGreen: FastQ Groomer PicardTools Mapping BWA GATK SAM assembly Add or Replace Groups BAM assembly including ReadGroups IndelRealigner UnifiedGenotyper DepthOfCoverage VCF file Depth file Alexis Dereeper Formation Bio-informatique Apimet 2013

6 Depth file Fastq (RC1) Fastq (RC2) Fastq (RC3) Fastq (RC4) ….
FastQ Groomer FastQ Groomer FastQ Groomer FastQ Groomer …. Mapping BWA Mapping BWA Mapping BWA Mapping BWA Add or Replace Groups Add or Replace Groups Add or Replace Groups Add or Replace Groups BAM with read group BAM with read group BAM with read group BAM with read group mergeSam Global BAM with read group IndelRealigner UnifiedGenotyper DepthOfCoverage VCF file Depth file 6 6

7 Formation Bio-informatique Apimet 2013
Format VCF (Variant Call Format) Avantages: description des variations pour chaque position + assignation aux génotypes ##fileformat=VCFv4.0 ##fileDate= ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data"> ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth"> ##INFO=<ID=AF,Number=.,Type=Float,Description="Allele Frequency"> ##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele"> ##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129"> ##INFO=<ID=H2,Number=0,Type=Flag,Description="HapMap2 membership"> ##FILTER=<ID=q10,Description="Quality below 10"> ##FILTER=<ID=s50,Description="Less than 50% of samples have data"> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality"> ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth"> ##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality"> #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA NA00002 rs G A PASS NS=3;DP=14;AF=0.5;DB;H GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 T A q10 NS=3;DP=11;AF= GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 Alexis Dereeper Formation Bio-informatique Apimet 2013

8 Filtered VCF Depth file Phased VCF Fastq (RC1) Fastq (RC2) Fastq (RC3)
FastQ Groomer FastQ Groomer FastQ Groomer FastQ Groomer …. Mapping BWA Mapping BWA Mapping BWA Mapping BWA Add or Replace Groups Add or Replace Groups Add or Replace Groups Add or Replace Groups BAM with read group BAM with read group BAM with read group BAM with read group mergeSam Global BAM with read group IndelRealigner UnifiedGenotyper DepthOfCoverage ReadBackedPhasing VariantFiltration Phased VCF Filtered VCF VCF file Depth file 8 8

9 Formation Bio-informatique Apimet 2013
Autres fonctionalités GATK Module DepthOfCoverage: Permet de renseigner de la profondeur de séquençage pour chaque gène, chaque position et chaque individu Module ReadBackedPhasing: Permet de définir dans la mesure du possible les associations d’allèles (phase ou haplotype) quand il y a hétérozygotie… Et non AGG GGA Alexis Dereeper Formation Bio-informatique Apimet 2013

10 Formation Bio-informatique Apimet 2013
SNiPlay: application Web pour l’analyse du polymorphisme Distance: Comparaison de séquences 2 à 2 et à chaque paire on associe une distance de divergence (calcul utilisant un modèle d’évolution donné) => Matrice de distance. On choisit l’arbre avec la plus courte somme de distances. Parcimonie: Sélectionne l’arbre nécessitant le minimum de changements évolutifs (d’évènements de substitution) Bonne approximation dans les régions où les séquences sont proches Likelihood: Méthode probabiliste basé sur une heuristique. Pour une topologie et longueurs de branches données, on estime pour chaque site la probabilité que le pattern de nucléotides observés ait évolué le long de cet arbre. On calcule la vraisemblance de tous les arbres possibles et on retient celui ayant la plus haute vraisemblance… Inférence Bayesienne: basé sur les Chaines de Markov Monte Carlo (MCMC) pour échantilloner des arbres à partir de distribution de topologies d’arbres. Alexis Dereeper Formation Bio-informatique Apimet 2013

11 Depth file Fastq (RC1) Fastq (RC2) Fastq (RC3) Fastq (RC4) ….
FastQ Groomer FastQ Groomer FastQ Groomer FastQ Groomer …. Mapping BWA Mapping BWA Mapping BWA Mapping BWA Add or Replace Groups Add or Replace Groups Add or Replace Groups Add or Replace Groups BAM with read group BAM with read group BAM with read group BAM with read group mergeSam Global BAM with read group IndelRealigner UnifiedGenotyper DepthOfCoverage VCF file Depth file 11 11

12 Charger fichier de profondeur
Options de SNiPlay Cocher format VCF Charger fichier VCF Charger référence Charger fichier de profondeur Sélectionner génome du Riz 12 12

13 Formation Bio-informatique Apimet 2013
Design de puces Illumina Fichier de soumission pour Illumina Fichier de génotypage Analyse avec le logiciel BeadStudio Coordonnées cartésiennes Alexis Dereeper Formation Bio-informatique Apimet 2013

14 Formation Bio-informatique Apimet 2013
Partage d’allèles entre groupes External file (optional) Individu, group Ind1, Table Ind2, Table Ind3, Table Ind4, East Ind5, East Ind6, East Ind7, East Ind8, West Alexis Dereeper Formation Bio-informatique Apimet 2013

15 Formation Bio-informatique Apimet 2013
Annotation des SNPs Alexis Dereeper Formation Bio-informatique Apimet 2013

16 Formation Bio-informatique Apimet 2013
Annotation des SNPs Alexis Dereeper Formation Bio-informatique Apimet 2013

17 Formation Bio-informatique Apimet 2013
Fichiers alléliques cARB cSYR cARA Format PED Format DARwin @DARwin ALLELIC - 2 33 20 N° Format .inp pour Phase Format pour TASSEL (génétique d’association) 33 10 P SSSSSSSSSS #cARB A A G G T C C A T T #cSYR A A G A T C C A T C 33 10:2 cARB A:A A:A G:G G:G T:T C:C C:C A:A T:T T:T cSYR A:A A:A G:G A:G T:T C:C C:C A:A T:T C:T cARA A:A A:A G:G G:G T:T C:C C:C A:A T:T T:T cORL A:A A:A G:G G:G T:T C:C C:C A:A T:T T:T cLAR A:G A:G A:G A:G C:T C:C C:C A:A T:T C:T Alexis Dereeper Formation Bio-informatique Apimet 2013

18 Analyse de diversité Librairie SeqLib

19 Formation Bio-informatique Apimet 2013
Haplotypes fréquents Haplotype peu fréquent Distribution des groupes Au sein de cet haplotype Distance séparant les 2 haplotypes (nb de mutations) Réseaux d’haplotypes Alexis Dereeper Formation Bio-informatique Apimet 2013