RNA structure: tRNA Primary structure Secondary structure

Présentation au sujet: "RNA structure: tRNA Primary structure Secondary structure"— Transcription de la présentation:

1 RNA structure: tRNA Primary structure Secondary structure
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAUAUCUGGAGGUCCUGUGUUCGAUCCCACAGAAUUCGCACCA Secondary structure Tertiary structure

2 RNA « Bio-Algorithmics »
Structure prediction given one sequence or given a set of (homologous) sequences Design: sequence prediction (given structure) Structural pattern-matching Comparison of two or several structures

3 RNA structure levels  Arc-annotated sequences
RNA structure ~ Graph of bounded degree, containing a (known) hamiltonian path.  Arc-annotated sequences Crossing (Secondary structure with pseudoknots) General (Tertiary structure) Plain (Primary structure) Nested (Secondary structure without pseudoknots)

4 The Chomsky Hierarchy Language Automaton Grammar Recognition
Dependency Biology Recursively Enumerable Languages Turing Machine Unrestricted Baa  A Undecidable Arbitrary Unknown Context- Sensitive Languages Linear-Bounded Context-Sensitive At  aA NP-Complete Crossing Pseudoknots, etc. Context- Free Languages Pushdown (stack) Context-Free S  gSc Polynomial Nested Orthodox 2o Structure Regular Languages Finite-State Machine Regular A  cA Linear Strictly Local Central Dogma From D. Searls

5 Prédiction de structure d’ARN
Séquence  Structure de plus faible énergie libre (selon un modèle d’énergie donné) GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAUAUCUGGAGGUCCUGUGUUCGAUCCCACAGAAUUCGCACCA

6 La prédiction de structure d’ARN est un problème NP-complet.
Lyngso, Pedersen 2000

7 Que faire face à un pb NP-complet ?
Chercher un algorithme exact fûté (mais sans garantie de temps) Chercher un algorithme d’approximation Chercher une heuristique d’approximation Contraindre les données du problème GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAUAUCUGGAGGUCCUGUGUUCGAUCCCACAGAAUUCGCACCA

8 Prédiction de structure: Nussinov (1978)
sans pseudo-nœud, en maximisant le nombre de nucléotides appariés. γ(i,j) = nombre d’appariements dans la structure entre les ième et jème nucléotides. δ(i,j) = 1 si i et j sont appariables, 0 sinon.

9 Algorithme de Nussinov (1978)
j i+1 j-1 i i+1 j j i j-1 2. 1. 3. i k k+1 j Les 4 façons possibles de construire la meilleure structure entre i et j, connaissant les meilleures sous-structures entre i+1 et j-1. 4.

10 Le plus utilisé : mfold (Zuker-Stiegler)

11 RNA « Bio-Algorithmics »
Structure prediction given one sequence or given a set of (homologous) sequences Design: sequence prediction (given structure) Structural pattern-matching Comparison of two or several structures