Les -omiques ENSPS 2 TIC-Santé 2012-2013

Plan Introduction: Les génomes : de la cartographie au séquençage, La définition des –omiques et leurs apparitions en Biologie L’analyse de l’information dans les données Les génomes : de la cartographie au séquençage, Les ARN messagers : de l’hybridation au DNA chip, La protéomique : Du gel bidimensionnel à la spectrométrie de masse. L’interactome. La métabolomique (l’analyse des métabolites)

ARN, transcriptome, transcriptomique

Plan Survol de la méthode L’évolution des puces Méthodes d’analyse

Measure of gene expression Xenograf Leukemia Megacaryoblast Measure of gene expression DNA arrays Small oligos (Affymetrix) Larger oligo (Sensichip Qiagen) PCR quantitative 96 wells plaques 384 wells MicroFluidic Cards

Analysis of total RNA Quality Avantages Agilent 2100 Bioanalyzer (RNA 6000 Nano LabChip kit; 5 ng of total RNA (200 pg ARN 6000 Pico LabChip kit) Ratio 28S/18S as a criteria for integrity Ratio rRNA 28S(4,7Kb)/ rRNA 18S(1,9Kb)~ 2 (>1,6) Quantity Purity SmartSpec 3000 (Biorad) determined by UV absorption 260 nm. Yield Mouse Brain (400-450 mg), 350-400 µg of total RNA (Expected from the protocol manufacturer, brain (1-1.5 µg RNA/mg tissue) Avantages Automation for better accuracy and reproducibility RNA are separated by capillary electrophoresis. Rapid visualisation of sample quality, quantity and purity High sensitivity with only a small amount of sample Significant time savings (up to12 samples in 30 minutes) Easy comparison or sharing of sample data Simple, robust protocols

Agilent Bioanalyser 1. The sample moves through the micro channels from the sample well. 2. The sample is injected into the separation channel. 3. Sample components are electrophoretically separated. 4. Components are detected by their fluorescence and translated into gel-like images (bands) and electropherograms (peaks).

Agilent 2100 Bioanalyzer analysis

Affymetrix platform: instruments total RNA GeneArray Chip Oven 640 Fluidics Station 400 GeneArray® Scanner Microarray Suite Software controls instrument Scanner 3000 and Fluidics Station 400. provides array image acquisition provides the interface for the Affymetrix Lims software for data storage and management analyzes the array data Raw data as an image (fichier .dat)

Affymetrix standard eukaryotic gene expression assay.

Eukaryotic Target Labeling for GeneChip® Expression Analysis AAAAAAA – 3' 5' Total RNA TTTTTTT -5' T7 promoter 1. First Strand cDNA Synthesis (RT) AAAAAAA – 3' 5' Total RNA TTTTTTT -5' T7 promoter cDNA 2. Second Strand cDNA Synthesis (Polymerase) cDNA 5' AAAAAAA -3' TTTTTTT -5' cDNA T7 promoter 3. Transcription (T7Polym, XTP, UTP-biotin) 3’- UUUUUU-5' Labeled-cRNA b b b b b b b b b b b

Gene expression monitoring with oligonucleotide arrays 1.28 cm 1.28 cm Oligo chip oligonucleotide arrays 20 mm Fluorescence intensity image PM probe set 25 mer-oligo MM probe pair 20 mm One probe cell ACCCATCAGTACTAGTGGACTTGCC ACCCATCAGTACCAGTGGACTTGCC probe sequence: PM probe sequence: MM ATGTGTGGATTACCCATCAGTACTAGTGGACTTGCCAATATCGGATGGA gene reference sequence mRNA gene: target 5’ 3’ 25 mer-oligo: probe

Affymetrix GeneChip® Arrays are manufactured through a process that combines photolithography and combinational chemistry.

Human Genome U133 (HG-U133) Set A (represent ~33,000 full-length genes and some EST clusters) . Specifications Number of Arrays in Set 2 Array Size Standard format Feature Size 20 µm Oligonucleotide Probe Length 25mer Probe Pairs/Sequence ~16 Sensitivity 1:100,000 Control sequences Hybridization controls bioB, bioC, bioD and cre Poly A controls dap, lys, phe, thr, and trp Maintenance Genes actin, GAPDH, hexokinase

Scanning resolution : 3 m 64 pixels (8x8) per probe cell in average DAT file 1 Probe cell : 24m/24m Scanning resolution : 3 m 64 pixels (8x8) per probe cell in average Intensity 300 # of pixels Probe cell Avg Intensity = 300 75% percentile value

Evolution des puces

1st Catalog GeneChip® Product Affymetrix Evolution Lancement commercial Premier brevet microarrays U133 Set Collaboration avec Roche 10K SNP Array Science West Sacramento Manufacturing Roche AmpliChipTM launched 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 1st Catalog GeneChip® Product Développement Technologique Commercialisation Marchés spécifiques

Un génome complet sur une puce Expression génique Recherche Fondamentale Développement Pharmaceutique Recherche clinique Marché Analyse des SNPs A/A B/B A/B Reséquençage A C G T A A A T A G G A T T G G C A T

Galette, Puces et carrés 11µm Millions de sondes identiques * 5” 5” 1.28cm Environ 1,3 millions de cararés par puce Puce/galette We talk a lot about "wafers", "chips", and "features". This is a graphical representation. We've mirrored the technology in the semiconductor industry, photolithography, with life sciences. We do manufacture on wafers. These wafers are 5-inch-by-5-inch pieces of glass. In our whole-genome products we get 49 individual chips out of each wafer, and on each one of those chips there are over 1,300,000 unique features, and each one of those features has millions of identical DNA probes on them.

Graver de plus en plus fin Date Taille en micron Carrés/puce 1996 100 16,000 1997 50 65,000 1998 24 256,000 2000 20 400,000 2002 18 500,000 2003 11 1,300,000 We used to manufacture at a 100-micron feature size, in 1996. Today, six short years later, we're at an 18-micron feature size for our new human products. We've gone from 16,000 features on a single chip to over 1,300,000 features. That's one of the powers of photolithography: each time we reduce that feature size in half, we increase the amount of information we're able to provide by a factor of four, keeping our costs constant--in effect, decreasing our cost per feature by 75%. This has a very significant value for our customers, because we haven't increased the chip pricing. We've provided far more information for the same price. At this point, when we look at the cost per feature, we don't believe there's anybody that can approach where we're at today in the marketplace.

Puces par galette 7 x 7 20 x 20 80 x 80 49 puces/galettes ~60K genes/puce Switched Order of the Slides here -- talk to flexible formats from the wafer:array perspective As we move to these clinical applications, it's going to require changes in how we deliver the product to our customers. Affymetrix' platform is an extremely flexible platform We sold whole wafers to Perlegen, when they interrogated over 60 million features on a single chip. As we discussed, our 49-format chips have about 500,000 features on them. We produce products with up to 400 chips on a wafer today, and each one of those chips has about 20,000 features. As we indicated earlier, the cost of a wafer is a constant, regardless of how many features or how many chips we cut it into. And so you can imagine, as we look forward--we can dice the product up to meet the information content needs of any marketplace, whether it's very high information content, like Perlegen scanning the fifty genomes, or a smaller subset of markers that might be used in clinical or diagnostic tests. 400 puces/galette ~2200 genes/puces 6400 puces/galette ~50 genes/puce

Graver plus fin Taille du carré 18um 11um 8um 5um 49 400 Format 1600 500,000 1,400,000 2,600,000 6,500,000 400 20,000 Format 110,000 100,000 500,000 1600 4,900 13,000 25,000 64,000 2500 3,000 8,000 16,000 40,000

Nombre de génes /puce Taille du carré 18um 11um 8um 5um 49 400 Format 23,000 64,000 118,000 295,500 400 Format 900 5,000 4,500 22,700 1600 200 600 1,200 3,000 2500 150 400 750 2,000 *22 sondes par transcrit

La puissance de la photolitographie 600,000 Euros par carré 500,000 400,000 Carré par puce 300,000 200,000 As has been the case in the semiconductor industry, our manufacturing process benefits from Moore’s law. This chart shows, in red, that over time we have been increasing the amount of information on our chips from 16,000 to over 500,000 features on a chip while we have been decreasing the price per datapoint to our customers, *shown in yellow. 100,000 1996 1997 1998 1999 2000 2001 2002 Carré par chip

Diminution des carrés 11 mm carré 5 mm carré 2 mm carré Produits actuels

Contrôle de qualité de la puce Vérification du design Vérification de la synthése In addition to the assurance of quality through the process, we also test arrays at the end. I’d like to go over this testing with you for our expression profiling arrays. Our general QC strategy is to verify 3 things- design, synthesis, and signal. Vérification du signal

Le dessin du masque est important Analyse de séquence Création Du masque A C G T GG Affymetrix Design Overview One of the things I’d like to spend a few moments on is chip design. We’re hearing more and more from customers that they don’t want to spend time designing arrays—and have consequently observed a trend towards pre-synthesized arrays. The reason for this is the enormous complexity of the genome—and translating that to array and probe designs that work. We have built expertise to annotate the genome, select sequences, select probes from those sequences, and then design masks that represent that information content. These mask sets are fixed—they store the information about what probes go where and what probes are used to represent each transcript. Génotypage SNP PM MM Expression génique

Synthése combinatoire 4N sondes peuvent être synthétisé en 4 x N étapes 100 étapes 425 25mers (1.12 X1015 oligos ) The technology is truly remarkable. To illustrate the power - here’s a quick example - 4 to the N number of probes can be synthesized with 4X N chemistry steps. So for an array of 16 20mer probes, it may require 80 cycles to synthesize, But to synthesize all possible 9mers, you could perform that in 4X9 or 36 chemistry cycles. So, in less than 100 steps, you can have the known human genome on one chip. To verify the acceptable synthesis of that array, one could confirm the acceptable synthesis of the 36 chemistry cycles. In doing so, all oligos would be verified. We leverage the power of photo-lithography to assure quality in our processes Synthése linéaire: 500,000 25 mers = 12.5 m étapes + deposition 20,000 60 mers = 1.2 m étapes + deposition

Sources de variabilité Haut Biologie La source principale de variabilité Préparation des échantillons Dépends des échantillons et de l’opérateur Système Dépends des puces, des appareils Et de l’opérateur Sample 1 Sample 2 Sample 3 Bas

L’usine affymetrix (GMP)

Systéme affymetrix Software Puces Data Analysis Fluidics Station Scanner Puces The GeneChip System consists of arrays, fluidics, a scanner and software. We also sell hybridization ovens fluidics stations scanners and software. 48 Chip Carousel for Walk-away freedom Integrated Experiment/Sample tracking Temperature controlled environment to maintain long-term sample integrity at (15 °C)

Applications Analyse ADN Expression Taille Du marché Time 1998 2000 Affymetrix targets markets representing a significant opportunity, now and well into the future. Today, we serve the Pharmaceutical industry, the academic biomedical research community, and the diagnostic research market. They represent a combined ~$80B per year spend in R&D, with an annual growth rate of ~12%. This doesn’t take into consideration other markets where GeneChip technology could be used, such as environmental monitoring and agricultural markets, to name just two. This slide shows you the 2 areas for which we develop products and their relative growth and sizes. 1998 2000 2002 2004 2006 2010 2012 Time

Puces par organisme PROKARYA EUKARYA Sequence Databases Rat Human E. coli Mouse Drosophila P. aeruginosa Yeast B. subtilis Arabidopsis This is a branch slide to the array products section (a drill-down within the RNA Expression Products section). The GeneChip Expression products are represented on this phylogenetic tree. We can go into more detail on any of the products listed here (click on the product for more detail). Arrays offered in the Affymetrix catalog are depicted in blue Arrays available in the Made-to-Order program are in magenta. We also offer reagents (yellow), and Custom Expression arrays (green). C. elegans Sequence Databases

# of publications/annum Utilisation des puces Recherche Phase 0 Discovery Applications cliniques Validation et Optimisation Essais cliniques et pré-cliniques Publications utilisant les puces # of publications/annum

Essais cliniques et pré-cliniques Validation de cibles Recherche Phase 0 Validation et Optimisation Discovery Applications cliniques Validation and Optimization Essais cliniques et pré-cliniques

Essais cliniques et pré-cliniques GeneChip Technology in Pharma/Healthcare Continuum Essais cliniques et pré-cliniques Toxicologie >30 essais cliniques Discovery Applications cliniques Validation and Optimization Pre-Clinical and Clinical Trials

Plate-forme à haut débit Utilisation industrielle Puces en microplaques Permet de séquencer ou de génotyper totalement un individu

HTA: 6mm x 6mm well 18um 10um 5um 96 well 5,051 65,455 16,364 Transcripts/Genes Per plate 485,000 1,571,000 6,284,000 96 well 2,778 9,000 36,000 SNPs Per plate 267,000 864,000 3,456,000 Base Pairs 96 well 13,900 45,000 180,000 Per plate 1,334,400 4,320,000 17,280,000

Compréhension d’une maladie génétique Liaison et association Genome entier Description Mapping 10K 2006 : 500K CustomSeq Future: 10x Expression analysis Tag arrays NetAffx Produit Cartographie fine Reduction pour des gènes candidats Analyse Séquence Identification Des variants In the area of DNA analysis, the customer need is understanding the genetics of disease or drug response. This workflow is from a recent Science review article. Demand for denser whole genome scans is growing rapidly. We recently launched Mapping 10K to genotype 10,000 SNPs – this is the highest content commercial product available for whole genome scans. We are continuing to extending that assay to 100,000 SNPs and more (Project Centurion). Sequence analysis is another area of focus. We have launched CustomSeq to resequence up to 30 kb on a single array and will extend that to much higher densities also. [We have not targeted the fine mapping or genotyping market to date. We are working with partners, like ParAllele Bioscience, to develop assays that can take advantage of our high density arrays.] [We see great synergies between our DNA and RNA products, and customers have already begun to use these together] Old: So if you look at the DNA analysis product strategy, we've always had whole-genome-based products and candidate-region products. We've had the HuSNP assay, and we've sold whole wafers to Perlegen for SNP and haplotype discovery. In the candidate-region analysis, we've had the GenFlex Tag Array. What we've recently introduced is an array that enables you to interrogate 10,000 SNPs in a single experiment, as well as CustomSeq which is a 30-kilobyte resequencing chip enabling a very efficient resequencing of genomes. Both of these are first-generation products that, over time, as we continue to shrink feature size, will enable us to put far more information on a chip, reducing the cost to the customer and increasing efficiency. Tests fonctionnels Transcriptome Glazier, Nadeau, & Aitman, Science 20 Dec 2002, p. 2345

General complexity reduction scheme 500K SNPs et plus … 100 + 10,000 + The unique advantage of our new Mapping 10K product is in the efficiency of the assay. Other technologies require individual primers for each SNP. Analyzing 10,000 SNPs using most technologies requires tens of thousands of primer pairs and many 96-well plates. Can be costly. Our assay uses only a single primer pair to amplify all 10,000 (actually 11,555) SNPs across the genome. Using our high density photolithographic chips, we can then simultaneously genotype each of these SNPs on a single GeneChip array. This assay is highly scalable and we are expanding this product line to cover over 100,000 SNPs under a project we call Centurion. As previously reported, we remain on track to start providing limited early access to Centurion by end of year, with full commercial launch in 2004. While the Mapping 10K targets the linkage market (genetic analysis in families), we expect Centurion to open the doors to true whole genome association studies (genetic analysis in case/control populations). (Note that we do use 3-4 PCR reactions to get enough sample, but these are 4 parallel PCRs with a single primer rather than 4 serial PCRs) If you look at the 10K product, what we're bringing to the market is a new way of thinking about how to interrogate whole-genome-based SNPs. We're able to reduce the complexity that's required. What we had is a single amplification process, one restriction enzyme, and the chip starts out with SNPs. These SNPs span the entire human genome. To do a similar experiment today, you'd have to stock 10,000 primer pairs, do 10,000 individual amplifications, put those samples into 100-micron titer plates and run the experiment. We're bringing a tremendous amount of efficiency, cost savings, and this is an extremely leverageable concept to far higher information content. At this point in time, Perlegen is doing large-scale whole-genome SNP-based analysis using over 1.5 million SNPs on the Affymetrix platform. Our goal over the next several years is to enable our other customers to perform similar-level whole-genome analysis. General complexity reduction scheme Hybridization-based allele discrimination

De 400 microsatellite à 1 SNP pour 100Kb This graphic represents the genome coverage of the previous standard for whole genome scans: a panel of 400 microsatellites. The blue represents microsatellite locations, the black represents gaps in the human genome sequence, and white represents uncovered space between the markers. Note the difference of genome coverage of the Mapping 10K (actually 11,555 SNPs). The red represents regions of genome coverage. Note how much greater the coverage of the genome is [Flip back and forth if desired]. This increased genetic power, coupled with our more efficient assay, is what is helping our customers to find better results faster. Blue = microsatellites Black = Gaps in coverage Red = at least 1 SNP per 100 kb

Nombre de SNPs par puces Taille d’un carré 18um 11um 8um 5um 49 12,500 35,000 65,000 162,500 400 Format 500 2,750 2,500 12,500 1600 125 325 625 1,600 2500 75 200 400 1000 * 40 sondes par SNPs

Reséquençage Reséquence 30 Kb The second product we have recently launched is our new CustomSeq program. Customers can design custom arrays containing up to 30 kb of any sequence, whether it be one long region or many exons. The very high sequence content from a single experiment essentially gives customers very looooong reads, reducing the amount of time spent assembling and curating many smaller, sometimes ambiguous bits. The CustomSeq product is a resequencing product that interrogates 30 kilobytes of double-stranded DNA, or 60 kilobytes in total. It can either be one contiguous region or several discontiguous regions. We believe it has broad application: an extremely fast, efficient, and easy-to-use product that, again, is very scalable to much higher information content as we continue to shrink feature size. It is a custom-based product designed, and can work with any genome that we are given. A C G T A A A T A G G A T T G G C A T

Nombre de base/ puce Taille du carré 18um 11um 8um 5um 49 400 Format 63,000 175,000 325,000 812,500 400 Format 2,500 14,000 12,500 62,500 1600 500 1,600 3,000 8,000 2500 375 1,000 2,000 5,000 *8 sondes par base

Recherche clinique et génomique appliquée Marché 1998 2000 2002 2004 2006 2010 2012 Temps

Nouveau format pour le haut débit At this point in time, at the Affymetrix research lab, we've got an 80-by-80 array, or 6,400 chips, out of a single wafer. We believe, to meet the needs of the diagnostic marketplace, you're going to have to have an extremely high-density manufacturing process to be able to provide adequate content at a very low cost. We believe Affymetrix is uniquely positioned to do this.

Aspects réglementaires NCCLS

Pipeline en recherche clinique Obtention des échantillons Dessin des puces Préparation et hybridation Analyse et rapport

Les applications en clinique cliniques Recherche Clinical Applications Validation et Optimisation clinique

Roche AmpliChipTM AmpliChip CYP450 CYP2D6 & CYP2C19 genotyping Analyzes 2 CYP2C19 and 31 CYP2D6 alleles Accounts for ~99% of known poor and ultra-rapid metabolizer genetic variation worldwide “Powered by Affymetrix” * Photo courtesy of Roche Diagnostics

Génomique appliquée Identification Diagnostique Tests Applications chez l’homme Agro-alimentaire Identification Diagnostique Tests In our next phase of growth, we will look to spread the use of Affymetrix’ GeneChip technology into Applied Markets. Our chips, by enabling Identification, Diagnostics, and General Testing, can be used in a number of applications, across all organisms. Examples of Human applications include identity testing, nutriceuticals…broadly, consumer genetics Examples of Animal applications include animal feed testing, animal diagnostics, breeding Examples of Plant applications include plant breeding, crop protection, species identification Examples of Microbial applications include environmental testing, some infectious disease identification and testing Microbiologie Génomique des plantes

Les puces à ADN Une révolution en génétique Environnement Agro-alimentaire Tracabilité des aliments Diagnostique Santé humaine Agriculture We will: drive the Affymetrix GeneChip platform to ubiquity in the broad life science market As opposed to: focusing on every dollar out of a smaller number of key markets, with a whole product solution delivered completely by Affymetrix Recherche fondamentale Médecine personalisée

Analyse du transcriptome