Analyse de données NGS par Galaxy Nettoyage, contrôle qualité, alignement, polymorphismes Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 But du TP: 1- Galaxy vs ligne de commande 2- Comprendre les fichiers FASTQ 3- Nettoyage des données Illumina (FASTQ) 4- Réaliser un assemblage 5- Réaliser un mapping de reads Illumina sur une séquence de reference 6- Nettoyage d’un fichier SAM multiple Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
CIRAD Server : http://gohelle.cirad.fr/galaxy/ 1- Galaxy CIRAD Server : http://gohelle.cirad.fr/galaxy/ Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 OUTILS DONNEES Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 APPLICATION WEB - Système “Click'n'Play” - transparent pour l’utilisateur Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 APPLICATION WEB - Système “Click'n'Play” - transparent pour l’utilisateur MODULAIRE - Nombreuses briques par défaut (déjà intégrées) - Ajout de briques à façon Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 APPLICATION WEB - Système “Click'n'Play” - transparent pour l’utilisateur MODULAIRE - Nombreuses briques par défaut (déjà intégrées) - Ajout de briques à façon MULTIPLE - Basé sur un serveur Web (Apache...) - Sur une machine unique machine, ou un cluster... Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 APPLICATION WEB - Système “Click'n'Play” - transparent pour l’utilisateur MODULAIRE - Nombreuses briques par défaut (déjà intégrées) - Ajout de briques à façon MULTIPLE - Basé sur un serveur Web (Apache...) - Sur une machine unique machine, ou un cluster... BUT - Simple support - Beaucoup moins puissant qu’un terminal - Seulement pour des analyses de routine - Seulement pour des données de taille limitée Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 CONNEXION POUR LE COURS: http://gohelle.cirad.fr/galaxy/ Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Se connecter... Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Ajouter des données... Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Importer des données depuis les librairies partagées Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Importer des données depuis les librairies partagées Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Fichier FASTQ→ Fichier TEXT STRUCTURE: @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb @HWUSI-EAS454_0006:1:37:16314:3410#CTTGTA AGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGTGGTGGCCG `bTbbccccceeeeeceeeecccYeedded`ceec]dddde^a`deeeec\`dddcbaadadYd`]]Jc_^bc^^\ Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 NOM DE SEQUENCE @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb Présentation de François Sabot Alexis Dereeper Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 CIBA courses – Brasil 2011 Alexis Dereeper, François Sabot Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 IUPAC SEQUENCE @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb Qualité codée en caractères ASCII Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 @HWUSI-EAS454_0006:1:112:14105:5498#CTTGTA CGCCAAGAAGTGTAGCAAAACGGCAGAGCTCGTGGATTAAACAAACAGAGGATTTCGGTGAGGATTGAGGGGGAGT + cfffcfeffdeefefffcffffffffcffeffffdffffafcfffffdffffdfefeddf^eececfffdfcbffb f → Qualité = 38 (102 – 64) Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Qu’est-ce que la QUALITE ? La valeur de qualité Q correspond à la probabilité pour la base correspondante soit incorrecte Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
FASTQC: contrôle qualité http://www.bioinformatics.bbsrc.ac.uk/projects/download.html#fastqc Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Pourquoi avons-nous besoin de nettoyer ? Pour enlever les adaptateurs ou amorces restants, ainsi que les séquences de mauvaise qualité → CutAdapt Présentation de François Sabot Alexis Dereeper Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 CIBA courses – Brasil 2011 Alexis Dereeper, François Sabot Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 70 7 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Vos données sont maintenant prêtes à être analysées… Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Concatenate files Présentation de François Sabot Alexis Dereeper Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 CIBA courses – Brasil 2011 Alexis Dereeper, François Sabot Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Untested Tools → NGS → Assembly → Assemble with MIRA Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 BLAST des contigs putatifs contre la réference Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 BLAST des contigs putatifs contre la réference Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Séparer les séquences par noms d’individus RC1, RC2... Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Séparer les séquences par noms d’individus RC1, RC2... Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Séparer les séquences par noms d’individus RC1, RC2... Utilisation d’expressions régulières via Galaxy: → RC[13456789] & remove reads => garder RC2 → RC[123456789]_ & remove reads => garder RC10 Présentation de François Sabot Alexis Dereeper Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 CIBA courses – Brasil 2011 Alexis Dereeper, François Sabot Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Séparer les séquences par noms d’individus RC1, RC2... Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Mapping: Mapper des reads 'pair-end‘ sur une référence 1- Calculer les positions de chaque read Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Mapping: Mapper des reads 'pair-end‘ sur une référence 1- Calculer les positions de chaque read 2- Associer les positions de chaque membre de paires Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Mapping: Mapper des reads 'pair-end‘ sur une référence 1- Calculer les positions de chaque read 2- Associer les positions de chaque membre de paires 3- Selection des positions les plus probables respectant les conditions Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Mapping: Mapper des reads 'pair-end‘ sur une référence 1- Calculer les positions de chaque read 2- Associer les positions de chaque membre de paires 3- Selection des positions les plus probables respectant les conditions 4- Editer un fichier de sortie SAM Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Reference From History: Shared data/Formation/PreProcess/reference.fasta Library: Paired-end FASTQ files: Depuis votre historique BWA setting to use: Commonly Used Désélectionner “Suppress the header in the output SAM file” Cliquer Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Fichier de sortie SAM (Sequence Alignment/Map) Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Tri de fichier SAM par coordonnées Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Création de Workflow pour une analyse automatique Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Workflow: comment éviter de lancer tous les processus à la main Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot
Burkina Faso - Bobo Dioulasso - 2012 Présentation de François Sabot Alexis Dereeper Burkina Faso - Bobo Dioulasso - 2012 Alexis Dereeper, François Sabot