La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Modélisation et simulation multi-échelle prédictive pour la biologie.

Présentations similaires


Présentation au sujet: "Modélisation et simulation multi-échelle prédictive pour la biologie."— Transcription de la présentation:

1 Modélisation et simulation multi-échelle prédictive pour la biologie

2 IInteractions moléculaires faible (Stacking et liaison hydrogène) et leur rôle dans les molécules biologiques; Outil: Méthodes Quantiques: DFT et méthodes de perturbation IIDéveloppement de modèles à léchelle mésoscopique pour étudier la thermodynamique de lADN; Outil: Modèle de Physique Statistique (thermodynamqiue statistique hors équilibre) IIIDéveloppement de modèles à léchelle macroscopique pour des nanostructures dADN Outil: Modèle à deux états IVDéveloppement dune nouvelle méthode pour le traitement de la flexibilité des molécules biologiques

3 Problème: VDW ignorées dans la DFT Solutions: 2 Stratégies * Ajouter un terme empirique afin de corriger le comportement longue portée dans les fonctionnelles; * Une nouvelle génération de fonctionnelle : Méta hybride I-1 DFT et interaction de van der Waals Dkhissi, Blossey. Chem. Phys. Lett. 439 (2007) 35-39

4 H-bond structures of dihydrated AT base pairsStacking structures of dihydrated AT base pairs The preference for S structures of nucleic acids base pairs in an aqueous environment is due to hydrophilic interactions of a rather small amount of water molecules with the base pairs and is not due to a hydrophobic interaction between a large bulk of solvent and base pair as is generally believed. I-2Density Functional Theory and Correlated ab Initio Studies on Microhydrated Adenine-Thymine Dkhissi, Blossey. JPCB. 112 (2008) The dominant intermolecular interactions of adenine-thymine pairs are hydrogen- bonding and Π-stacking interactions. Experimentally, In a nonpolar solvent and also in the gas phase the base pairs prefer a planar hydrogen bonded arrangement, whereas in bulk water, the stacked configurations are preferred HB structuresStacking structures AT base pair179 AT-H 2 O2823 AT-2(H 2 O)3637 Ab Initio Interaction Energies (kCal/mol) of Selected Structures of the Adenine-Thymine Complex

5 E (kcal/mol) 0 -58,8 -67,3 -89,3 I-3Aggregation for the GNNQQNY Peptide: Atomic scale modeling Aim of the work: Study of the GNNQQNY monomer and dimer to investigate the very first step of -sheet formation

6 ΔE = -146,76 kcal/molΔE = kcal/mol * Excellent agreement between theoretical and experimental data (Parallel) * The importance of hydrogen bonding in the stabilization energy for formation of the sheets Renvez, Dkhissi. Biophysical Journal (to be Submitted) I-3Aggregation for the GNNQQNY Peptide: Atomic scale modeling

7 IIStabilité thermodynamique des gènes

8

9

10

11

12

13

14

15

16

17

18

19

20

21

22

23 Melting domains for H. Sapiens actins we found very similar melting profiles also in, and actins of other vertebrates as: Canis familiaris (dog), Bos Taurus (cow), Danio Rerio (zebrafish), Gallus Gallus (chicken) etc... The correspondence between thermodynamic boundaries with the introns positions The sequences (b) and c) which host 5 introns. The two remaining of the total 7 intron correspond to stability boundaries. Melting domains for animal actins

24 melting curves for Drosophila Melanogaster (a,b), the fruit fly, and Caenorhabditis Elegans (c), a worm. The Drosophila actins have at most one intron in the coding region either in 15-1 or These positions differ from the vertebrates positions The melting analysis however reveals few stability boundaries close to the positions 43-3, 86-3, and 330-3, which are the introns position of vertebrates actins

25 Melting domains for actin sequences of the A. Thaliana. The introns positions of actins sequences of higher plants are highly conserved (Litterature), which indicates that these introns date back to the early evolution of plants In 3 out of the 9 Arabidopsis sequences shown (a, d, f)we find a correspondence of a thermal boundary and an intron at As in the Drosophila and C. Elegans sequences in general stability boundaries tend to be found at vertebrates positions 43-3, 86-3, and In few cases the correspondence is very striking, as in Fig (d). Melting domains for plant actins

26 Average melting curves from 21 green plant actin genes As reference four of the most commonly found introns positions for actin genes. The averaging confirms the existence of a sharp stability boundary close to the 43-3 position. Two weaker boundaries are found close to the positions 86-3 and With the 9 sequences from A. Thaliana we have in total 21 plant actin genes. For each sequence the melting curves were calculated and then averaged. Melting domains for plant actins

27 the number of introns and their positions are highly variable in fungi actin genes: their number vary from 0 to 7 A sharp stability boundary close to the 43-3 position and some weaker ones appearing close to positions and in the case (b). This correlation is absent in the case (c) Melting domains for fungi actins Melting curves for the budding yeast Saccharomyces Cerevisiae (a), for Neurospora Crassa (b) and for Candida Albicans (c)

28

29 IIIY-DNA melting: a short tale of two scales Molecular Melting 5–CAATGGATCGCGATCCATTG–3 Extrinsic melting of Y-DNA Dkhissi et al. J. Phys: Conden Matter. 21 (2009)

30 IVLes Modes Statiques: Une nouvelle méthode pour traiter la fléxibilité des molécules biologique

31 Qu'est-que la flexibilité ? capacité intrinsèque d'une molécule à changer de conformation en réponse à une contrainte extérieure (environnement, interactions...) essentiel pour la prédiction de : structures et propriétés de molécules isolées (folding) formation de complexes macromoléculaires (docking) Applications biologie structurale : prédiction de structures tridimensionnelles recherche médicale : étude des interactions, des processus cellulaires et physiologiques recherche pharmacologique : criblage de nouveaux médicaments nanobiotechnologies : biopuces... Traitement actuel de la flexibilité

32 Prise en compte de la flexibilité ! ! les algorithmes actuels ne considèrent pas la flexibilité totale des systèmes docking rigide (à flexibilité implicite) soft docking (complémentarité de surface) cross docking (échantillons multiples) docking semi-rigide (à flexibilité explicite) flexibilité partielle (ligand, chaînes latérales, backbone, site actif...) zones flexibles déterminées par dynamique moléculaire, analyse vibratoire... Méthodes coûteuses en ressources informatiques Résultats peu satisfaisants pour les mouvements de grande amplitude Challenge : introduire la flexibilité dans les procédures de docking avec un coût informatique raisonnable Traitement actuel de la flexibilité

33 Concept recherche de déformations pertinentes à la fois pour la molécule seule et complexée pas de calcul de l'état de transition mais seulement des déformations induites par une contrainte extérieure Méthode calcul de la matrice hessienne A (libre choix du modèle énergétique) application d'une contrainte B sur chaque atome, dans chaque direction solution : déformation moléculaire X (réponse à la contrainte) A B Résoudre A.X + B = 0 Energie 3xN-6 déformations (3 x N – 6) x (3 x N – 6) Création et validation d'un logiciel : Flexible Les modes statiques: Concept et méthodes

34

35 Asp25 Asp25' Ile50 Forme fermée (en présence d'un ligand) 1HHP Forme ouverte 1TW7 levier volet interfac e domaine terminal poches de liaison site actif Application au cas de la protéase du VIH-1

36 Quelques propriétés identifiées : Quelques propriétés identifiées : Corrélation site actif / poches de liaison 1, 2, 3 Influence du domaine terminal et interfacial sur la stabilité du site actif 3, 4 Corrélation leviers / volets 5 Fermeture des volets à l'arrimage du ligand 6, 7 Différences de flexibilité entre protéine ouverte / fermée, 4 moins d'interaction entre monomères 1 Short et al. Biochemistry (2000), Perrymane et al. Protein Science (2004), Harte et al. Proc. Nat. Ac. Sc. USA (1990), Ishima et al. Structure (1999), 7. 5 Perryman et al. Biopolymers (2006), Hornak et al. PNAS (2006,) Jagodzinski et al. Proceedings of the 46th IEEE Conf. (2007). Application au cas de la protéase du VIH-1

37 Variation de la distance Asp25/Asp25' (modifications du site actif) voisins de Asp25 (22-27) poches de liaison (81-84) interface (4-9) extrêmités C et N-terminales (1-3 et 97-99) Des contraintes appliquées sure les poches de liaison et l'interface modifient le site actif > 1 Å 0.5 Å < 0.5 Å Application au cas de la protéase du VIH-1

38 : Réponse au pincement de tous les couples d'atomes : Différences protéine fermée / ouverte : Disparition de séquences de l'interface Affaiblissement des interactions inter- monomères Application au cas de la protéase du VIH-1

39 Résultats Une méthode nouvelle et compétitive basée sur le concept induced-fit évaluation de la flexibilité moléculaire Advantages considération de la flexibilité totale un seul calcul pour le stockage de l'ensemble des déformations (gain de temps) Perspectives introduire les effets non linéaires optimiser l'algorithme intégrer l'approche des Modes Statiques dans des stratégies nouvelles ou existantes (prédiction de docking...) Conclusions

40


Télécharger ppt "Modélisation et simulation multi-échelle prédictive pour la biologie."

Présentations similaires


Annonces Google