La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

LEPISSAGE ALTERNATIF DE LARN Comment un même gène peut être à lorigine de la synthèse de protéines différentes ? Guy Boudenc Lycée Saint Joseph GAILLAC.

Présentations similaires


Présentation au sujet: "LEPISSAGE ALTERNATIF DE LARN Comment un même gène peut être à lorigine de la synthèse de protéines différentes ? Guy Boudenc Lycée Saint Joseph GAILLAC."— Transcription de la présentation:

1 LEPISSAGE ALTERNATIF DE LARN Comment un même gène peut être à lorigine de la synthèse de protéines différentes ? Guy Boudenc Lycée Saint Joseph GAILLAC

2 La synthèse des protéines nécessite, dans un premier temps, le transfert vers le cytoplasme de linformation génétique située sur la molécule dADN. Cette dernière est localisée dans le noyau.

3 La transcription TAC ADN : Brin transcrit Sens de lecture ACAAGGGATTGTGGTTTTCTAAGTTCC La transcription conduit à la synthèse dun brin dARN pré-messager qui va être déplacé dans le cytoplasme Brin dARN pré-messager

4 La traduction fait correspondre un acide aminé à chaque codon TAC ADN : Brin transcrit Sens de lecture ACAAGGGATTGTGGTTTTCTAAGTTCC La traduction conduit à la synthèse dune protéine spécifique (séquence dacides aminés) à partir dun brin dARN contenu dans le cytoplasme. Brin dARN pré-messager Méthionine Cystéine Sérine Leucine Thréonine Proline Lysine Acide aspartique Sérine Arginine

5 Le génome humain compte entre et gènes. Le protéome correspond à lensemble des protéines codées par lensemble des gènes. Le protéome humain est estimé de à protéines, selon les auteurs. Depardieu/INSERM

6 Le modèle présenté précédemment ne permet pas dexpliquer la différence entre le nombre de gènes ( ) et le nombre de protéines (entre et ). En effet ce modèle fait correspondre un fragment dADN à un fragment dARN et donc à une protéine.

7 Du fait de la complémentarité des bases, le brin dARN localisé dans le cytoplasme devrait shybrider en totalité avec le brin dADN qui a servi de modèle. Comment expliquer cette différence entre le nombre de gènes et le nombre de protéines ?

8 LARN (en bleu) présent dans le cytoplasme ne shybride pas exactement avec le brin dADN (en rouge) qui a servi de modèle à la transcription. P. Chambon, Scientific American - mai 1981 Hybridation ADN/ARN de lovalbumine de poule Interprétation

9 Les gènes ne correspondent pas à une séquence continue de nucléotides. Linformation contenue sur certaines parties de lADN ne se retrouve pas sur lARN.

10 Des parties de lARN pré- messager sont donc éliminées après la transcription. Les introns sont les parties éliminées et les exons les parties conservées au cours de ces modifications post-transcriptionnelles. Exon 1Exon 2Exon 3Exon 4Exon 5 Intron 1Intron 3Intron 2Intron 4

11 LARN pré-messager subit donc des modifications post- transcriptionnelles et se transforme en ARN messager. Cest lépissage : élimination des introns et jonction des exons.

12 Mais ce nest pas encore suffisant pour obtenir plusieurs protéines à partir dun même gène.

13 Certaines cellules des follicules thyroïdiens sécrètent deux protéines : la calcitonine et la CGRP (Calcitonine Gene Regulated Peptide). Ces deux protéines sont déterminées par le même gène (Calc-1).

14 Dans les cellules des follicules thyroïdiens on isole lARN pré-messager ainsi que les ARN messagers à lorigine de la synthèse de la calcitonine et de la CGRP.

15 LARN pré-messager résultant de la transcription du gène Calc-1 est constitué de 6 exons et 5 introns Exon 1Exon 2Exon 3Exon 4Exon 5Exon 6I 1I 5I 4I 3I 2 Il est formé de nucléotides.

16 Lutilisation de sondes spécifiques de chaque intron et exon permet de connaître la constitution des ARN messagers de la calcitonine et de la CGRP. Exon 1Exon 2Exon 3Exon 4Exon 5Exon 6I 1I 5I 4I 3I 2

17 Le tableau ci-dessous regroupe les résultats obtenus. E1E2E3E4E5E6I1I2I3I4I5 ARN pm ARNm Calcitonine ARNm CGRP Présence de la sonde - Absence de la sonde

18 LARNm de la calcitonine possède les exons 1, 2, 3 et 4. LARNm de la CGRP possède les exons 1, 2, 3, 5 et 6. E1E2E3E4E5E6I1I2I3I4I5 ARN pm ARNm Calcitonine ARNm CGRP

19 A partir du même ARN pré- messager il y a eu deux ARN messagers différents. ARN pré- messager ARN messager Calcitonine ARN messager CGRP Il y a eu un épissage alternatif

20 Ces deux ARN messagers différents seront à lorigine de deux protéines différentes. Un même gène peut être à lorigine de protéines différentes.

21 BILAN ARN pré-messager EPISSAGE ALTERNATIF ARNm 1ARNm 3ARNm 2 PROTEINE 1PROTEINE 2PROTEINE 3


Télécharger ppt "LEPISSAGE ALTERNATIF DE LARN Comment un même gène peut être à lorigine de la synthèse de protéines différentes ? Guy Boudenc Lycée Saint Joseph GAILLAC."

Présentations similaires


Annonces Google