La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

BIOLOGIE DE LA CELLULE TD3 Transcription de lADN Traduction des ARNm.

Présentations similaires


Présentation au sujet: "BIOLOGIE DE LA CELLULE TD3 Transcription de lADN Traduction des ARNm."— Transcription de la présentation:

1 BIOLOGIE DE LA CELLULE TD3 Transcription de lADN Traduction des ARNm

2 1-Toutes les synthèses dARN ont-elles lieu au même endroit dans une cellule eucaryote ? Où ? 2- Quels sont les différents types dARN produits ? A quoi servent-ils ? 3- Explicitez les éléments fondamentaux de la région promotrice chez les procaryotes 4- Combien existe-t-il dARN pol chez les eucaryotes ? Chez les procaryotes ? 5- Quest-ce-quun transcrit primaire (pré-ARN) chez les eucaryotes ? 6- Citez les 3 étapes de maturation dun pré-ARNm et expliquez brièvement leurs rôles 7- Pourquoi peut-on sattendre à une coloration verte et rose du nucléole lors du test de Brachet 8- Donnez la définition de « code génétique » ainsi que les 3 caractéristiques de ce code que vous expliquerez 9- Donnez le nom et le mécanisme de fonctionnement (réaction(s)) des enzymes permettant lactivation des ARNt Annotez le schéma ci-dessous : 53 Gène 1 Gène 2 La molécule d'ADN est chauffée ce qui casse les liaisons faibles et sépare les deux brins d'ADN. On ajoute alors l'ARNm correspondant à ce gène qui s'associe au brin d'ADN portant la séquence complémentaire et on obtient une hybridation ADN-ARN. Commentez le schéma ci-dessous : Hybridation ADN-ARN Boucles dADN non hybridé Hybrides ADN-ARN

3 Complétez le schéma suivant (codon, anticodon, ARNt, aa-ARNt, aa, chaîne polypeptidique, extrémités 3 et 5 de lARNm, codon initiateur, sens de déplacement du ribosome, …). Indiquez et donnez la signification des sites A et P du ribosome UAC A U G A A A U C G G U C Commentez cette figure : de quoi sagit-il ; son origine ; son devenir noyau cytoplasme

4 400 nm Donner un titre à la micrographie A AB Le code génétique 1 er nucléotide 2 e nucléotide 3 e nucléotide La micrographie B correspond à une structure en arbre de noël : la transcription dun ADNr par plusieurs ARN pol I en même temps. Légendez et donnez le sens de progression de lARN pol I Ribosome ARNm Polypeptide 70 nm Pour lannée prochaine changer ce code génétique car on y trouve des « T » et cela risque de prêter à confusion…

5 Voici le brin matrice dune séquence codante procaryote (NB : la séquence de de fixation du ribosome nest pas représentée). Indiquez la séquence de son brin complémentaire, transcrivez la séquence du brin matrice, puis recherchez les cadres ouverts de lecture et traduisez-les. Quauriez-vous fait si le brin matrice ne vous avait pas été désigné ou si lorientation des brins navait pas été précisée sur les séquences ? 3 GTACGGCTATACCCAAGCGAAGTCTGTGGCTATGTTTACTCTATTTTTTATGG 5 ADN

6 Transcription de lADN ADN ARN PROCARYOTE EUCARYOTE Initiation Elongation Terminaison Facteur sigma (-35) Boîte de Prinbow (-10) ARN pol TATA box (-30 ; ARN pol II) ARN pol I grands ARNr ARN pol II ARNm + snRNA ARN pol III ARNt + ARNr 5S Dépendante ou non du Facteur Rho ARN pol II : signal de polyadénylation et clivage par une endonucléase Initiation de la traduction PROCARYOTE EUCARYOTE


Télécharger ppt "BIOLOGIE DE LA CELLULE TD3 Transcription de lADN Traduction des ARNm."

Présentations similaires


Annonces Google