La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Laurent Bianchetti Plate-forme Bioinformatique de Strasbourg (BIPS) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent.

Présentations similaires


Présentation au sujet: "Laurent Bianchetti Plate-forme Bioinformatique de Strasbourg (BIPS) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent."— Transcription de la présentation:

1 Laurent Bianchetti Plate-forme Bioinformatique de Strasbourg (BIPS) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent Fries Illkirch France 5, 12, 20 et 21 Décembre 2012 Institut Universitaire de Technologie de Colmar Génie biologique 1

2 Madame Christine Le-Jeune Laboratoire Vigne Biotechnologies et Environnement, EA-3991 Université de Haute-Alsace, UFR PEPS 33, rue de Herrlisheim, Colmar cedex France Dr Olivier Poch Laboratoire de Bioinformatique et Génomique Intégrative (LBGI) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent Fries Illkirch France Les étudiants de lIUT de Biotechnologie de Colmar 2

3 Partie I (Mer. 5 Déc.) 1h30 cours + 2h30 TD Bioinformatique appliquée à la biologie moléculaire Partie II ( Mer. 12 Déc.) 1h30 cours + 2h30 TD Banques de séquences biologiques et comparaison de séquences Partie III ( Jeu. 20 Déc.) 1h30 cours + 2h30 TD Bioinformatique à lère de la biologie globale ou « omics » Partie IV ( Ven. 21 Déc.) 1h30 articles et discussion Nouveautés et perspectives (« News and views ») Examen ( Ven. 21 Déc.) 1h30 3

4 4

5 5 Disponibles sur PC/Mac en proximité de la paillasse Outils académiques ou commerciaux Outils mono-poste/mono-utilisateur (commerciaux) ou mutualisés (académiques)

6 Avantages: - Gratuits ou très peu onéreux (contribution) - Usage illimité - Applications téléchargeables dun site web ou bien disponibles en interface web - Peuvent être mis en commun sur serveur de calcul 6 Inconvénients: -Une batterie doutils peut être nécessaire pour mener un traitement complet (!= intégration) -Le graphisme peut ne pas être une priorité (programmes en ligne de commande) -Le développement peut sarrêter faute de moyen

7 7 Avantages: -Interface graphique puissante -Interactivité -Fonctionnalités/Intégration -Support, manuels, webinars, etc … -Portabilité (PC windows/Linux, MAC) Inconvénients: - Payants -Complexité des licences (modules en suppléments) - Monoposte, voire mono-utilisateur -Format propriétaire (compatibilité limitée avec dautres logiciels)

8 8

9 9 HardwareSystème dexploitation(OS) VersionProcesseur MacMac OSX intel, X PPCuniversel PCWindowsXP, Vista, 732 binary digits (*) 64 LinuxDebian, Ubuntu, Redhat, etc … 32 binary digits 64 Serveur de calcul Solaris (Unix) Linux

10 10 Windows ( Menu démarrer => Panneau de configuration => Système et maintenance => Système)

11 11 Linux => System monitor => onglet System Les programmes 32 bits sont compatibles avec les processeurs 64 Pas linverse !!!!

12 12 Compatibilité doutils académiques avec les différentes plate-formes FinchTV Web, Outils > EMBOSS seqmerge

13 13 NGS Avadis Vector NTI GCK Compatibilité doutils commerciaux avec les différentes plate-formes

14 14 Wine est un outil gratuit qui permet dexécuter des applications windows sous Linux et Mac OS X

15 15

16 16 ApE, Gene Construction Kit Format compatibles Fasta, Genbank, etc … Représentation graphique de plasmide (annotation) Carte de restriction Clonage assisté (couper/coller,vecteur/insert) Gel délectrophorèse virtuel Annotation de séquence : ORF, cassette de clonage Edition de séquence GGATCC CCTAGG BamH1 Le logiciel doit assister ce couper/coller spécial et vérifier la compatibilité des extrémités insert/vecteur

17 17 GGATCCCGATGCGATCAGTACGATAGACATGACAGCTGGATCC CCTAGGGCTACGCTAGTCATGCTATCTGTACTGTCGACCTAGG CGATGCGATCAGTAGGATCCCGATAGACATGACAGCT GGTACGCTAGTCATCCTAGGGCTATCTGTACTGTCGA 1) Vecteur => couper 2) Insert => copie 3) Clonage => collage BamH1 GGATCCCGATGCGATCAGTACGATAGACATGACAGCTGGATCC CCTAGGGCTACGCTAGTCATGCTATCTGTACTGTCGACCTAGG CGATGCGATCAGTA GGTACGCTAGTCAT CGATAGAC GCTATCTG

18 18 GATCCCGATGCGATCAGTACGATAGACATGACAGCTG CGATGCGATCAGTAGGATCCCGATAGACATGACAGCT GGTACGCTAGTCATCCTAGGGCTATCTGTACTGTCGA GGTACGCTAGTCATGCTATCTGTACTGTCGACCCTAG 1) Vecteur => couper spécial (mode enzyme de restriction) 2) Insert => copie spéciale GGATCC CCTAGG 3) Clonage => collage spécial CGATCAGTAG GCTAGTCATCCTAG GATCCCGATAGACAT GGCTATCTGTA GATCCCGATGCGATCAGTACGATAGACATGACAGCTG GGTACGCTAGTCATGCTATCTGTACTGTCGACCCTAG (fonction inversion implémentée)

19 19

20 20

21 21 FinchTV, ApE, seqmerge, EMBOSS (abiview) Lecture du format abi, fasta Représentation graphique des chromatogrammes de séquençage Séquence « par défaut » générée automatiquement Navigation sur la séquence Modulation de la hauteur et largeur des pics Edition de la séquence choisie par le séquenceur Affichage de plusieurs chromatogrammes alignés

22 22

23 23 seqmerge, Vector NTI, DNAstar Lecture du format abi, fasta Affichage dempilement et dalignement de reads Facilité dassemblage et désassemblage Rapidité dassemblage Séquence consensus Export (fasta, MSF)

24 À lIGBMC, seqmerge est installé sur le serveur solaris « bips » On accède à « bips » par un programme appelé Xwindow (ou xterm) Le Xwindow est installé sur le PC ou le MAC de lutilisateur Le Xwindow permet dafficher des outils à interface graphique après connection à un serveur connection au serveur par login/mot de passe Environnement gcg

25 25 Comment se procurer un programme Xwindow ? Comment obtenir laffichage graphique ? Icône « terminal » >ssh -X => download Xming

26 26 1)2) 3)4) Paramétrage dXming sous windows

27 >gcg (puis return) >seqmerge& (pui return) Ne tapper PAS Seqmerge& ou SeqMerge& ou Seq merge&

28

29

30 Double click

31 Menu File du « Seqmerge contig editor » => show traces

32 32 Primer3 (http://primer3.wi.mit.edu/)http://primer3.wi.mit.edu/ EMBOSS (primer3) ApE GCK (Tools > PCR analysis) etc … Paramétrage (=> Primer3) Spécificité (éléments répétés => ) (Paralogie) (Domaines « lego ») (segments de faible complexité => EMBOSS (etandem) Haut-débit (EMBOSS en ligne de commande)

33 33

34 34 Web, Outils > EMBOSS European Molecular Biology Software Suite revcomp => reverse complement vectorstrip => supprime de la séquence de vecteur aux extrêmités 5 et 3 dune séquence / vecscreen (NCBI) transeq => traduction dun cDNA extractseq => extrait une région dune séquence en donnant les positions de début et de fin sixpack => affiche une séquence dADN « query » et sa traduction dans les 6 cadres de lecture Etc … Explorez EMBOSS !!

35 35 LicencePrimer designClonage virtuel Séquençage (chromato.) Assemblage de fragments GCKCom. ApEAca. Vector NTI Com. DNAstar Lasergene core suite Com. FinchTVAca. Seqmerge (Accelrys) Aca. EMBOSSAca. NGS Genomic suite Récapitulatif

36 36 Bonjour, Invitrogen a passé Vector NTI en version 11 et celle ci est devenu payante, sachant que toutes les licences gratuites de vector NTI 10 expirerons fin mars.... et vu les prix on ne peut pas se permettre de prendre une licence même avec la promotion actuel : 1-year Academic License EUR EUR % 3-year Academic License EUR EUR % Vu que je possède avec mon équipe une base assez conséquente de vecteurs, j'aimerais trouver d'une part un logiciel équivalent à vector NTI mais gratuit et d'autre part que celui-ci soit compatible avec le format d'enregistrement de vector NTI c'est à dire les fichier.gb comme cela je n'aurai quà exporter ma base de données et non à reprendre toutes les séquences. J'ai entendu parler de ApE mais celui-ci ne me paraît pas terrible Je vais pour le moment tester Serial Cloner. Donc si vous avez de bon logiciels gratuits, faites moi signe Posté en nov 2008 sur Futura forum

37 Il nexiste pas doutil bioinformatique idéal pour assister la biologie moléculaire. Les outils académiques ont lavantage dêtre gratuits mais leur usage peut être laborieux (ligne de commande, manuel incomplet, fonctionnalités qui manquent, etc …) et doivent être combinés. Les outils commerciaux offrent du confort mais il faut y mettre le prix dans un contexte de réduction des fonds alloués à la recherche 37

38 Adaptez-vous à loutil utilisé dans votre laboratoire daccueil. Ne réclamez pas loutil que vous utilisiez dans le laboratoire précédent si une autre solution logicielle est disponible sur place. Soyez ouvert à lutilisation de plusieurs outils, ils se complètent. Sil ny a pas doutil, soyez dabord débrouillard, plutôt que dépensier. Vous nen serez que plus appréciés. Donnez la préférence aux outils académiques si lon vous donne du temps, sinon demandez un outil commercial si vous êtes dans lurgence ou en « production ». Si vous utilisez des outils, noubliez pas à la fin dune présentation, ou dans une publication de les citer (référence) 38

39 1) Tutorial de GCK sur version « demo » du logiciel - Manipulation de base (carte de restriction, ORF, …) - Clonage virtuel assisté - Gel délectrophorèse virtuel - Importation dun plasmide (Genbank) dans GCK 2) Traduction dun cDNA et design de primers dans EMBOSS 4) Exploration de FinchTV 5) Démonstration dassemblage de fragments et visualisation de chromatogrammes de séquençage dans seqmerge 39


Télécharger ppt "Laurent Bianchetti Plate-forme Bioinformatique de Strasbourg (BIPS) Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) 1 rue Laurent."

Présentations similaires


Annonces Google