La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Une tartine dévolution Plume! Vincent Bonhomme Institut Français de Pondichéry.

Présentations similaires


Présentation au sujet: "Une tartine dévolution Plume! Vincent Bonhomme Institut Français de Pondichéry."— Transcription de la présentation:

1 Une tartine dévolution Plume! Vincent Bonhomme Institut Français de Pondichéry

2 Kézaco lévolution ? Évolution = Modification du vivant au cours du temps & Une logique pour le vivant

3 Quest-ce que le vivant ? Le vivant se caractérise par : 1.Un métabolisme 2.La reproduction 3.Un fonctionnement héritable et modifiable Autrement dit tout ce qui utilise des ressources au sein dun environnement et qui fait des descendants qui lui ressemblent.

4 Pourquoi Darwin est-il une superstar ?

5 Charles Darwin ( ) Le papa de lévolution

6 Darwin naît dans une famille anglicane au début du XIX e où lEglise verrouille largement les explications naturalistes : 1. Les biologistes sont ~unanimement convaincus du fixisme dune Nature bien faite ou dun transformisme transcendant ; 2. Lêtre humain est dessence divine et à son Règne bien à lécart des plantes et des (autres) animaux. Contexte scientifique et historique

7 Darwin devient biologiste. Il embarque sur le Beagle où il embrasse la biodiversité mondiale, notamment insulaire. Il y constate en filigrane dune proximité géographique, une correspondance des adaptations locales avec des environnements contrastés. Il lit Malthus, constate lhérédité, entretient des relations étroites avec des géologues, des fondus de fossiles, des éleveurs de pigeons [...]. Il perd la foi suite au décès de sa fille. Et prépare pendant 20 ans lOrigine des Espèces, publié avec fracas en Le génie = 1% de dinspiration, 99% de travail – John Dryden

8 « Comme il naît plus d'individus de chaque espèce qu'il n'en peut survivre, il se produit une lutte pour la vie. Dans un environnement donné, les organismes qui varient d'une manière qui leur est profitable, auront une meilleure chance de survivre et se retrouveront naturellement choisis. » Adapté de lOrigine des Espèces. Darwin superstar

9 Une tartine dévolution Puisque : 1.Il existe une variation entre individus dune même espèce ; 2.Que ces variations sont héritables ; 3.Que ces différences sont responsables dune +/- bonne survie et/ou reproduction. Alors, lenvironnement sélectionne les individus les mieux adaptés. Cest la sélection naturelle.

10 Toute lévolution en un dessin

11 Pas besoin de compétition ! 2.1 descendants / gen° 2.0 descendants / gen° 2.1 n / (2.1 n n )

12 Qui était là en premier, la poule ou loeuf ?

13 Ce qui est reproduit, hérité et pérenne cest linformation nécessaire pour faire un nouveau réplicateur a vie courte. Les poules sont des avatars inventés par les oeufs pour faire dautres oeufs. Les avatars du gène Reproduction Réplication Développement Décodage Génotype Message Phénotype Expression

14 1. Une molécule chimique : lADN 2. Alphabet de 4 lettres : { A, T, C, G } 3. A-T et C-G sont complémentaires ; les deux brins contiennent donc le même message. LADN, support de linformation génétique (i) La présence dun sucre, le lactose, induit la synthèse de protéines qui permettent de métaboliser le lactose. Nobel de Jacob & Monod paires de bases Comment sexprime cette information ? Comment est stockée linformation génétique ?

15 LADN, support de linformation génétique (ii) Quelles conséquences pour lindividu et la population ? Comment est modifiée linformation génétique ? Erreurs de copie Agent chimique Agent physique (amiante, rayons Uvs, etc.) 1.Les mutations modifient au hasard linformation génétique. 2.La plupart du temps les mutations sont délétères/silencieuses. Parfois avantageuses. 3.La variabilité génétique ( = le potentiel dadaptation), est donc créée au hasard.

16 Pour dire quatre fois la même chose Lévolution est plutôt une compétition entre mutations quune compétition entre individus. Lenvironnement trie des mutations créées au hasard. Lévolution mélange donc des processus déterministes (sélection naturelle) et aléatoires (mutations). La mutation propose, la sélection dispose.

17 La mutation propose, la sélection dispose… Et la dérive sinterpose.

18 Lévolution au hasard de la dérive (i) Population doriginePopulation fondatrice Le hasard est une force évolutive à part entière

19 Lévolution au hasard de la dérive (ii) 100 individus 10 individus Les petites populations favorisent la dérive plutôt que la sélection naturelle. Mais à long terme, même les grandes populations fixent des mutations neutres…

20 Lévolution au hasard de la dérive (iii)

21 Exemples dadaptation

22 Exemples dadaptations

23 Dessine-moi une espèce

24 Gorteria (Asteraceae). Johnson & Midgley Ellis & Johnson 2009 Micro / Macroévolution

25

26 LOrigine des Espèces Amour libre Tous les individus peuvent échanger du matériel génétique. Ils forment une espèce. Chacun sa vie Ici, la faille isole deux populations. Sans séparation physique, il suffit quil y ait une préférence dans le choix daccouplement. Les retrouvailles ratées A force daccumuler les populations de part et dautre de la faille ne peuvent plus se reproduire. Les populations sont devenues espèces.

27 Une spéciation Les arbres phylogénétiques permettent de visualiser les relations de parenté entre espèces. 2 espèces 1 espèce, 2 populations. 1 espèce, 1 population. macroévolution microévolution temps

28 Comment reconstruit-on les liens entre espèces ?

29 Phylogénie 101 (i) Selon ces critères: 1. (Belette ; Gazelle) sont les plus similaires. 2. La Rainette ressemble plus à (Belette ; Gazelle) quaux autres. 3. Le Requin ressemble plus à (Rainette ; (Belette ; Gazelle)) quà la Méduse. Soit : ((((Belette – Gazelle ) – Rainette ) – Requin ) – Méduse ) On pourrait aussi (faire mieux) compter les différences entre ADNs. Jai une gauche et une droite Jai des os Jai des poils Belettexxx Gazellexxx Rainettexx Requinx Méduse

30 Phylogénie 101 (ii) ((((Belette – Gazelle ) – Rainette ) – Requin ) – Méduse ) Deux arbres dapparences différentes, mais aux relations de parenté identiques. On peut démontrer avec la phylogénie que nous avons un ancêtre commun avec le Champignon de Paris, avant den avoir un avec la Fraise des Bois. BeletteGazelleRainetteRequin Méduse Belette Gazelle RainetteRequinMéduse

31 Descend-on vraiment du singe ?

32 Portrait de famille (i) HumainChimpanzéGorille Orang-Outang Réponse rhétorico-frustrante: Singe désigne lensemble des organismes qui partagent des caractéristiques communes (), pas une espèce. De la même façon,Oiseau désigne lensemble des bipèdes sans poils, pas lAutruche, lHirondelle ou le Colibri.

33 Portrait de famille (ii) HumainChimpanzéGorille Orang-Outang 1. Nous ne descendons pas autres singes mais partageons un ancêtre commun. 2. Le cousin le plus proche du Chimpanzé, cest Nous. 3. LOrang-Outang nest pas plus proche du Gorille que de Nous. 4. Personne nest plus évolué quun autre. Réponse biologie évolutive :

34 Sommes-nous si différents les uns des autres ?

35 TTTCCCTCGAGTGGTAGGGCGGTGAGCGGCCGATAGTGACGCATGAAATGTTCAAACGGCAATCAATTAAGGTTGCAGTTCATG GTAGTGACATCAATTGCATTAACCGTATGAGAGGTTATGTTGCCATTATTAACTACTAATCGACTGCATTATCACGGACAGTTCCTAA GGCACACCGTGGATGTTACGGTGAGGTACCCACTTCCCCGGAGTACACCGCGTCCACCGCGAAGGCCTTAGAAGCGCCGGCGA AAAACGGCATGTTTATTACATTGCCCGAGAAGTCTAATCATAGATTCGTATATTGATCATGGGTTTCGGTGACCTAGGACGGGTGAC GTTCATCTAAGGTCCGTTGTGCCGTCACCGAGCAGCGATACGGAACCATGGCGTCGTATCCTTGATTGAAGCGGTCACATGTACA TGTTTCATTGAACTGAGTACCACTTTTAGAGCGTCACGTCGGCTGTATTTCCCAAGTGTGGGAACCCGCCGCGAATGCACCCTCC TGGATACTGCGATACGAAGGGTAAAGGGCTGTAAGACCCGACTCTTCTTAACAATCGGTATGGACCATGGTGCCGCGGATCCCCA TAACTAATAGCCAGGGGTTGTCCCATCTATAATTCTCGCGAGATTACGTGTGGCAGTACGTAGAAACTGCCGTGACAGAACCTATG CACTGCGCGCGTGGGCATGACACCTCTCTATTATAGTTACAGACGTTTCGGGCCTCATGTGACCCTGTCCTAAGAGGACCCTCAT ACACATCGGGATTACTCGCTCACGGGTGGGCGGATCTCCGATAATCAAAAGCGGCGGCGATGTCTTGAAGTACGGCGTTTATGCT ATCAGCGTCCGACAGTTACATCGTTTGGCGCGAAAACCGGGCGCTTCTGAGGTTGGAAGGTCCTAGTTCCATTGCGCTGCGGC GTCATATAGGACGCTATCTAGTGGTGTACTCATTGTCACAACTCGAACTTTCGTATTGATGCTAGATCAGTTCTCTACACGCTGAAT CTAGTGACCTTCTGCATTATCGTGCCGGGCACTCGGATGCCGGCCTGGTTTTTTAGACTGCCTAGGATGTTGAGCTTGCAGCCAA ATGCGACTGTGTCTGCTTCTGCTTTCAGCAGTTGGGGTCTCCATGGTTCCGGTGGAGCACAGCCATGGGGTGCAAGGCCGCGC GGACAGACCCTAAGATGAGGGCTACGCCTGCCTCTTGGTGGTCACTTTCGAAGTTGTTAGCTCAGTCGCGAAGAACCAATGCTG CTCAGCCCGCTGTAGATAATGGCTAGGTACAAATACCGATTTAGTCAAATCAAAGAACGTACTAGAAAGCGCCGAAAGGATAAGAA CTACGGTGGACCGAAAATGCGGACACAATTCAGGGCCTCAGGGGATTAGTTGGGAAGACGAGCTTGGCAGTACCCTAGTTGGCT GTCTATACATCGTTGGAGCTCGGTGCCCTTATTAACGGCCTGTAACTACTTTTCCCTAAGCAAGGGTTTCTCTTATGTTGATTCGGA CTATGAACCAGCGTTCGCTACCTTTAAGGGTTAGGTGCCTTGTATTGACGTCCGCAGCATGGACTCACAACCGCGTCCGTAGTCC CGATAGTGTGTAGTGAAGCGTGGAGGCAGCATATATGTATACCGTTTGCGATAGCAGCAATTTAGAGGATTAAATTTTGATAATCGC TCGCTTGCACTTTTAATCGAATAGGCTGCTATCCTTAGGCTCAAATTATTGGTATGCCCTGTGAATACCTGGGCGATCACATAAGTG ACAGTAGCGCATTGATATACGTTGAATTCTGGGAAAAGGTAGGAAATTTCTCCGCATTAACCTCGCCAGCAATCTGACGAAGGAG GTAAAGATTGACGGACGGTCGAAGATGCCGCAGAGGACTATATCGACCGAGAGAAGTGCTAGATGGTCGGCACGAGGCTGACG GCGATCCGCATATTATGATCCCACTGTTCCGATGGCCGTAGGTCAGCTTTGCTACCATCCGTCATCATTCCAGGTGCGGTGGATTG TCTCACTCACGTTCATTTCGGTTTCGTGCCTGGTAGTAGTCTCAGATCGCACTCATGGGACCGCACGCTTGTCTTGGGGCACGG GCGTGGACAATTCTCGGGCGGAGGTATTCGCGGAGGCGATTCCCCCGGATGCTGTTCAGGAACTCCTGTAGCAATGTTACTTTC GTGGCGCCCGGCGTATGCGTGGCAAGTACAAAGGCGTCGATCGAGGGTTTCCAGCCGCACTAAGACACGTTAATACGTAAATCA TTTGACGCGAGTCCTACCGTAAGGGTGAATGATAGATGATACCTTTTTTGATAGGGAAGCTACTCTTGTGCTACAAATAACCCGACA TCTGCAGAGATTCGGGCACGCTCTACCTCACACGTGATTTATCGAAAATTAGGTTCCTAGTCCAGTCGCGTCTCCTTTTACTGCTT GCTTTCTTGCTCACGTTGGTTTCCCTCGCATACCATCAGGGGTAGCTGCTCTAGCACACCCGCAAACCCGTAACATGTCTTAGTG GAAGAGATTTTCTCAAGAAGGTCTGCGATGCAGTACGTTCATGTGAGTAAGAGCAAGGCCGGCCTCAGGTATCGCACCGGCAGA TCGATGTCGACGAGCAGACCCTTACCTTAGAGGGGCTAAAATTTAGGGGAGGGATTTTTGCGCGGGCAACGGAGCCCGGGAGG GCATGTCTACGATTCCGATCCAAACCGGTAGATCCAACGATGTGTAGGATCTTCGGTTTAGGGACCCTAGGCGGTTACCCATCCC TCCATGCGGACGGAATCCTACGTCTCCAGAACTTTAACCTCTCTGATGTACTTACTTCGATAGAATAGCCTAGGTATTCGCGAGTAT CGATACTGTGATTTTAATTAGCATGGTGTACTGCAACTAAGGCGCGGGAGACGGGCGACATAAGTAAGACTCTTCGCCCCATCTC GTCGTGATGCAGCTTACCTTCACTGCATCCATGCAAAGAGGGTCAATTCACGATTTAGTCAGTCTTAATTTGCCGTTGTGCGCAGC ACACAATCCGCACCTGATGAGTGCCCAAGAGGATGCAATATCGATCCTAGCGTCGAAAAATATCCCATTCATACCACACCGAACGG GTGACCCAGACTTGAAGTTCCTGAAGTAGAAATTCACATCCGAGCATCTTTATGTACTTATTCCCAAGCGAGGGGCGCGGTGCCG CCACCCGACAAGAGGCCGCCGAGTGAAGACCTTTAATATACTAGTTACATTTGTCGCGATATGGTCAGATAACGTTTTTCTTTGCA AACAGTGATTTACGGGACCCGACAACTATGAAGATGACGGTTGACCTACTAGGGCAATCAAGCCAATCGCTAGTACATTGTTAGTC GATGGAGATGACAGCTTCAGCGGTTCCCACCACGCTGACCGTTCAGCTTTTTGAGGGGTACCTAGCTCCGCCCCCGTTGAAGC GATCTTGGGGGCTAATCCATGCAGAAGACCTGGAACCTGTAAAGCTTGAGTCTCGCCTTCCTCCGTTAGACGTGACATTTTGGTC CAAATGACAAAGCCTCCGGGGTACGGACTGTTATAGTGGTACAACTGTCT Un millionième de mon génome

36 TTTCCCTCGAGTGGTAGGGCGGTGAGCGGCCGATAGTGACGCATGAAATGTTCAAACGGCAATCAATTAAGGTTGCAGTTCATG GTAGTGACATCAATTGCATTAACCGTATGAGAGGTTATGTTGCCATTATTAACTACTAATCGACTGCATTATCACGGACAGTTCCTAA GGCACACCGTGGATGTTACGGTGAGGTACCCACTTCCCCGGAGTACACCGCGTCCACCGCGAAGGCCTTAGAAGCGCCGGCGA AAAACGGCATGTTTATTACATTGCCCGAGAAGTCTAATCATAGATTCGTATATTGATCATGGGTTTCGGTGACCTAGGACGGGTGAC GTTCATCTAAGGTCCGTTGTGCCGTCACCGAGCAGCGATACGGAACCATGGCGTCGTATCCTTGATTGAAGCGGTCACATGTACA TGTTTCATTGAACTGAGTACCACTTTTAGAGCGTCACGTCGGCTGTATTTCCCAAGTGTGGGAACCCGCCGCGAATGCACCCTCC TGGATACTGCGATACGAAGGGTAAAGGGCTGTAAGACCCGACTCTTCTTAACAATCGGTATGGACCATGGTGCCGCGGATCCCCA TAACTAATAGCCAGGGGTTGTCCCATCTATAATTCTCGCGAGATTACGTGTGGCAGCACGTAGAAACTGCCGTGACAGAACCTATG CACTGCGCGCGTGGGCATGACACCTCTCTATTATAGTTACAGACGTTTCGGGCCTCATGTGACCCTGTCCTAAGAGGACCCTCAT ACACATCGGGATTACTCGCTCACGGGTGGGCGGATCTCCGATAATCAAAAGCGGCGGCGATGTCTTGAAGTACGGCGTTTATGCT ATCAGCGTCCGACAGTTACATCGTTTGGCGCGAAAACCGGGCGCTTCTGAGGTTGGAAGGTCCTAGTTCCATTGCGCTGCGGC GTCATATAGGACGCTATCTAGTGGTGTACTCATTGTCACAACTCGAACTTTCGTATTGATGCTAGATCAGTTCTCTACACGCTGAAT CTAGTGACCTTCTGCATTATCGTGCCGGGCACTCGGATGCCGGCCTGGTTTTTTAGACTGCCTAGGATGTTGAGCTTGCAGCCAA ATGCGACTGTGTCTGCTTCTGCTTTCAGCAGTTGGGGTCTCCATGGTTCCGGTGGAGCACAGCCATGGGGTGCAAGGCCGCGC GGACAGACCCTAAGATGAGGGCTACGCCTGCCTCTTGGTGGTCACTTTCGAAGTCGTTAGCTCAGTCGCGAAGAACCAATGCTG CTCAGCCCGCTGTAGATAATGGCTAGGTACAAATACCGATTTAGTCAAATCAAAGAACGTACTAGAAAGCGCCGAAAGGATAAGAA CTACGGTGGACCGAAAATGCGGACACAATTCAGGGCCTCAGGGGATTAGTTGGGAAGACGAGCTTGGCAGTACCCTAGTTGGCT GTCTATACATCGTTGGAGCTCGGTGCCCTTATTAACGGCCTGTAACTACTTTTCCCTAAGCAAGGGTTTCTCTTATGTTGATTCGGA CTATGAACCAGCGTTCGCTACCTTTAAGGGTTAGGTGCCTTGTATTGACGTCCGCAGCATGGACTCACAACCGCGTCCGTAGTCC CGATAGTGTGTAGTGAAGCGTGGAGGCAGCATATATGTATACCGTTTGCGATAGCAGCAATTTAGAGGATTAAATTTTGATAATCGC TCGCTTGCACTTTTAATCGAATAGGCTGCTATCCTTAGGCTCAAATTATTGGTATGCCCTGTGAATACCTGGGCGATCACATAAGTG ACAGTAGCGCATTGATATACGTTGAATTCTGGGAAAAGGTAGGAAATTTCTCCGCATTAACCTCGCCAGCAATCTGACGAAGGAG GTAAAGATTGACGGACGGTCGAAGATGCCGCAGAGGACTATATCGACCGAGAGAAGTGCTAGATGGTCGGCACGAGGCTGACG GCGATCCGCATATTATGATCCCACTGTTCCGATGGCCGTAGGTCAGCTTTGCTACCATCCGTCATCATTCCAGGTGCGGTGGATTG TCTCACTCACGTTCATTTCGGTTTCGTGCCTGGTAGTAGTCTCAGATCGCACTCATGGGACCGCACGCTTGTCTTGGGGCACGG GCGTGGACAATTCTCGGGCGGAGGTATTCGCGGAGGCGATTCCCCCGGATGCTGTTCAGGAACTCCTGTAGCAATGTTACTTTC GTGGCGCCCGGCGTATGCGTGGCAAGTACAAAGGCGTCGATCGAGGGTTTCCAGCCGCACTAAGACACGTTAATACGTAAATCA TTTGACGCGAGTCCTACCGTAAGGGTGAATGATAGATGATACCTTTTTTGATAGGGAAGCTACTCTTGTGCTACAGATAACCCGAC ATCTGCAGAGATTCGGGCACGCTCTACCTCACACGTGATTTATCGAAAATTAGGTTCCTAGTCCAGTCGCGTCTCCTTTTACTGCT TGCTTTCTTGCTCACGTTGGTTTCCCTCGCATACCATCAGGGGTAGCTGCTCTAGCACACCCGCAAACCCGTAACATGTCTTAGT GGAAGAGATTTTCTCAAGAAGGTCTGCGATGCAGTACGTTCATGTGAGTAAGAGCAAGGCCGGCCTCAGGTATCGCACCGGCAG ATCGATGTCGACGAGCAGACCCTTACCTTAGAGGGGCTAAAATTTAGGGGAGGGATTTTTGCGCGGGCAACGGAGCCCGGGAG GGCATGTCTACGATTCCGATCCAAACCGGTAGATCCAACGATGTGTAGGATCTTCGGTTTAGGGACCCTAGGCGGTTACCCATCC CTCCATGCGGACGGAATCCTACGTCTCCAGAACTTTAACCTCTCTGATGTACTTACTTCGATAGAATAGCCTAGGTATTCGCGAGTA TCGATACTGTGATTTTAATTAGCATGGTGTACTGCAACTAAGGCGCGGGAGACGGGCGACATAAGTGAGACTCTTCGCCCCATCT CGTCGTGATGCAGCTTACCTTCACTGCATCCATGCAAAGAGGGTCAATTCACGATTTAGTCAGTCTTAATTTGCCGTTGTGCGCAG CACACAATCCGCACCTGATGAGTGCCCAAGAGGATGCAATATCGATCCTAGCGTCGAAAAATATCCCATTCATACCACACCGAACG GGTGACCCAGACTTGAAGTTCCTGAAGTAGAAATTCACATCCGAGCATCTTTATGTACTTATTCCCAAGCGAGGGGCGCGGTGCC GCCACCCGACAAGAGGCCGCCGAGTGAAGACCTTTAATATACTAGTTACATTTGTCGCGATATGGTCAGATAACGTTTTTCTTTGC AAACAGTGATTTACGGGACCCGACAACTATGAAGATGACGGTTGACCTACTAGGGCAATCAAGCCAATCGCTAGTACATTGTTAGT CGATGGAGATGACAGCTTCAGCGGTTCCCACCACGCTGACCGTTCAGCTTTTTGAGGGGTACCTAGCTCCGCCCCCGTTGAAGC GATCTTGGGGGCTAATCCATGCAGAAGACCTGGAACCTGTAAAGCTTGAGTCTCGCCTTCCTCCGTTAGACGTGACATTTTGGTC CAAATGACAAAGCCTCCGGGGTACGGACTGTTATAGTGGTACAACTGTCT Différences moyennes entre deux êtres humains (~0,5%)

37 TTTCCCTCGAGTGGTAGGGCGGTGAGCGGCCGATAGTGACGCATGAAATGTTCAAACGGTAATCAATTAAGGTTGCAGTTCATGG TAGTGACATGAATTGCATTAACCGTATGAGAGGTTATGTTGCCATTATTAACTACTAATCGACTGCATTATCACGGACAGTTCCTAAG GCACACCGTGGATGTTACGGTGAGGTACCCACTTCCCCGGAGTACACCGCGTCCACCGCGAAGGCCTTAGAAGCGCCGGCGAA AAACGGCATGTTTATTACATTGCCCGAGAAGTCTAATCATAGATTCGTATATTGATCATGGGTTTCGGTGACCTAGGGCGGGTGAC GTTCATCTAAGGTCCGTTGTGCCGTGACCGAGCAGCGATACGGAACCATGGCGTCGTAACCTTGATTGAAGCGGTCACATGTACA TGTTTCATTGAACTGAGTACCACTTTTAGAGCGTCACGTCGGCTGTATTTCCCAAGTGTGGGAACCCGCCGCGAATGCACCCTCC TGGATACTGCGATACGAAGGGTAAAGGGCTGTAAGACCCGACTCTTCTTAACAATCGGTATGGACCATGGTGCCGCGGATCCCCA TAACTAATAGCCAGGGGTTGTCCCATCTATAATTCTCGCGAGATTACATGTGGCAGTACGTAGAAACTGCCGTGAGAGAACCTATG CACTGCGCGCGTGGGCATGACACCTCTCTATTATAGTTACAGACGTTTCGGGCCTCATGTGACCCTGTCCTAAGAGGACCCTCAT ACACATCGGGATTACTCGCTCACGGGTGGGCAGATCTCCGATAATCAAAAGCGGCGGCGATGTCTTGAAGTACGGCGTTTATGCT ATCAGCGTCCGACAGTTACATCGTTTGGCGCGAAAACCGGGCGCTTCTGAGGTTGGAAGGTCCTAGTTCCATTGCGCTGCGGC GTCATAGAGGACGCTATCTAGTGGTGTACTCATTGTCACAACTCGAACTTTCGTATTGATGCTAGATCAGTTCTCTACACGCTGAAT CTAGTGACCTTCTCCATTATCGTGCCGGGCACTCGGATGCCGGCCTGGTTTTTTAGACGGCCTAGGATGTTGAGCTTGCAGCCAA ATGCGACTGTGTCTGCTTCTGCTTTCAGCAGTTGGGGTCTCCATGGTTCCGGTGGAGCACAGCCATGGGGTGCAAGGCCGCGC GGACAGACCCTAAGATGAGGGCTACGCCTGCCTCTTGGTGGTCACTTTCGAAGTTGTTAGCTCAGTCGCGAAGAACCAATGCTG CTCAGCCCGCTGTAGATAATGGCTAGGTACAAATACCGATTTAGTCAAATCAAAGAACGTACTAGAAAGCGCCGAAAGGATAAGAA CTACGGTGGACCGAAAATGCGGACACAATTCAGGGCCTCAGGGGATTAGTTGGGAAGATGAGCTTGGCAGTACCCTAGTTGGCT GTCTATACATCGTTGGAGCTCGGTGCCCTTATTAACGGCCTGTAACTGCTTTTCCCTAAGCAAGGGTTTCTCTTATGTTGATTCGG ACTATGAACCAGCGTTGGCTACCTTTAAGGGTTAGGTGCCTTGTATTGACGTCCGCAGCATGGACTCAGAACCGCGTCCGTAGTC CCGATAGTGTGTAGTGAAGCCTGGAGGCAGCATATATGTATACCGTTTGCGATTGCAGCAATTTAGAGGATTAAATTTTGATAATCG CTCGCTTGCACTTTTAATCGAATAGGCTGCTATCCTTAGGCTCAAATTATTGGTATGCCCTGTGAATACCTGGGCGATCACATAAGT GACAGTAGCTCATTGATATACGTTGAATTCTGGGAAAAGGTAGGAAATTTCTCCGCATTAATGTCGCCAGCAATCTGACGAAGGAG GTAAAGATTGACGGACGGTCGAAGATGCCGCAGAGGACTATATGGACCGAGAGAAGTGCTGGATGGTCGGCACGAGGCTGACG GCGATCCGCATATTATGATCCCACTGTTCCGATGGCCTTAGGTCAGCTTTGCTACCATCCGTCATCATTCCAGGTGCGGTGGATTG TCTCACTCACGTTCATTTCGGTTTCGTGCCTGGTAGTAGTCTCAGATCGCACTCATGGGACCGCACGCTTGTCTTGGGGCAGGG GCGTGGACAATTCTCGGGCGGAGGTATTCGCGGAGGCGATTCCCCCGGATGCTGTTCAGGAACTCCTGTAGCAATGTTACTTTC GTGGCGCCCGGCGTATGCGTGGCAAGTACAAAGGCGTGGATCGAGGGTTTCCAGCCTCACTAAGACACGTTAATACGTAAATCA TTTGACGCGAGTCCTACCGTAAGGTTGAATGATAGATGATACCTTTTTTGATAGGGAAGCTACTCTTGTGCTACAAATAACCCGACA TCTGCAGAGATTCGGGCGCGCTCTACCTCACACGTGATTTATCGAAAATTAGGTTCCTAGTCCAGTCGCGTCTCCTTTTACTGCTT GCTTTCTTGCTCACGTTGGTTTCCCTCGCATACCATCAGGGGTAGCTGCTCTAGCACACCCGCAAACCCGTAACATGTCTTAGTG GATGAGATTTTCTCAAGAAGGTCTGCGATGCAGTACGTTCATGTGAGTAAGAGCAAGGCCGGCCTCAGGTATCGCACCGGCAGA TCGATGTCGACGAGCAGACCCTTACCTTAGAGGGGCTAAAATTTAGGGGAGGGATTTTTGCGCGGGCAACGGAGCCCGGGAGG GCATGTCTACGATTCCGATCCAAACCGGTAGATCCAACGATGTGTAGGATCTTCGGTTTAGGGACCCTAGGCGGTTACCCATCCC TCCATGCGGACGGAATCCTACGTCTCCAGAACTTTAACCTCTCTGATCTACTTACTTCGATAGAATAGCCTAGGTATTCGCGAGTAT CGATACTGTGATTTTAATTAGCATGGTGTACTGCAACTAAGGCGCGGGAGACGGGCGACATAAGTAAGACTCTTCGCCCCATCTC GTCGTGTTGCAGCTTACCTTCACTGCATCCATACAAAGAGGGTCAATTCACGATTTAGTCAGTCTTAATTTGCCGTTTTGCGCAGC ACACAATCCGCACCTGATGAGTGCCCAAGAGGATGCAATATCGATCCTAGCGTCGAAAAATATCCCATTCATACCACACCGAACGG GTGACCCAGACTTGAAGTTCCTGAAGTAGAAATTCACATCCGAGCATCTTTATGTACTTATTCCCAAGCGAGGGGCGCGGTGCCG CCACCCGACAAGAGGCCGCCGAGTGAAGACCTTTAATATACTAGTTACATTTGTCGCGATATGGTCAGATAACGTTTTTCTTTGCA AACAGTGATTTACGGGACCCGACAACTATGAAGATGACGGTTGACCTACTAGGGCAATCAAGCCAATCGCTAGTACATTGTTAGTC GATGGAGATGACAGCTTCAGCGGTTCCCACCACGCTGACCGTTCAGCTTTTTGAGGGGTGCCTAGCTCCGCCCCCGTTGAAGC GATCTTGGGGGCTAATCCATGCAGAAGACCTGGAACCTGTAAAGCTTGAGTCTCGCCTTCCTCCGTTAGACGTGACATTTTGGTC CAAATGACAAAGCCTCCGGGGTACGGACTGTTATAGTGGTACAACTGTCT Différences moyennes entre un homme et un chimpanzé (~2,5%)

38 Pourquoi le sexe cest bien ?

39 Parce que le mélange cest bien ! (i) Le sexe, cest de la recombinaison de variations génétiques. Les lapins tachés de marron nexistaient pas avant le sexe à la génération 0.

40 Parce que le mélange cest bien ! (ii) * * * * * * * Et cest toutes les variations qui sont remélangées. Les lapins blancs tâchés de marron nont ainsi pas à attendre la mutation yeux bleus.

41 Pourquoi le paon a-t-il lair dun crétin ?

42 La sélection sexuelle Il est machiste et partiellement faux de dire à une Paonne que ses couleurs ternes sont sélectionnées pour permettre de couver discrètement. Il est méchant mais vrai de rappeller à un Paon que cette parure de dragueur est un sérieux handicap au quotidien ! Un handicap pour la survie est sélectionné tant quil est plus petit que lavantage reproductif quil confère à son porteur.

43 Dimorphisme sexuel

44 Pourquoi les filles peu farouches ne courent pas les rues ?

45

46 Vers lanisogamie +- isogamie À investissement égal, deux stratégies opposées mais qui se valent : 1.Faire moins de gamètes mais plus gros ; 2.Faire plus de gamètes mais plus petits. Si la fécondation est interne, un conflit apparaît : 1.Pour une femelle, choisir le(s) meilleur(s) mâle(s) ; 2.Pour un mâle, féconder le maximum de femelles puisquil nest là que pour la conception. 1.Ce conflit est aggravé dans les cas de viviparité ; 2.Ce conflit est encore aggravé dans les cas où les jeunes nécessitent des soins parentaux. anisogamie

47 Pourquoi les lièvres ne courent-ils pas à la vitesse du son ?

48 Pourquoi les lièvres ne courent pas à la vitesse du son ? 1.Physiologiquement, parce que les coûts métaboliques ne sont pas linéaires ; 2.Evolutivement, parce quun avantage sélectif est par nature relatif (à lautre lièvre et au loup) ; 3.Les contraintes sont aussi dordre developpementales et phylogénétiques.

49 Et lhumain dans tout ça ?

50 Sélection artificielle et domestication Généralement, lhumain détruit la biodiversité. Mais de temps en temps, il en crée.

51 Héritabilité, génétique et culture Pourtant la culture est transmise* et elle nest pas génétique** ! * qui nest pas lapanage de lhumain **mais tout de même informationnelle

52 Et si on redéroulait le film de la vie ?

53 Des dinosaures et de la contingence Les Oiseaux sont les représentants actuels des Dinosaures. Plus diversifiés que les Mammifères. Nous sommes toujours dans lère des Dinosaures - Guillaume Lecointre. Le déclin des Dinosaures est généralement vu ayant permis la radiation des Mammifères. Mais si le météorite nétait pas tombé ? Ou plus tard, ou plus tôt ? Dune façon générale, si on redéroulait le film de la vie à partir dun point donné, à quel point le résultat actuel serait différent ?

54 En guise de conclusion

55 Ce que lévolution nest pas 1.Ni 100% déterministe, ni 100% aléatoire 2.Lévolution na pas de but propre 2.Lévolution nest pas parfaite 3.Lévolution nest pas une théorie moins solide que la gravité 4. Lévolution nest pas forcément complexifiante 5.Lévolution nest pas une alternative au créationnisme 6. …

56 Ce que lévolution est « L'unité et la diversité du vivant s'expliquent par l'évolution, et le moteur de l'évolution adaptative est la sélection naturelle. » Charles Darwin Lévolution est le résultat de linteraction permanente et à toutes les échelles du tri quexerce lenvironnement entre les variations qui existent parmi les différents individus.

57 Merci ! Et à François pour ses dessins intelligents : fdolambi.net Autres illustrations Commons.

58

59 Pourquoi le créationnisme cest des bêtises (i/)

60 Pourquoi le créationnisme cest des bêtises (ii/)


Télécharger ppt "Une tartine dévolution Plume! Vincent Bonhomme Institut Français de Pondichéry."

Présentations similaires


Annonces Google