La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Sensibilité de graines espacées du type Subset seed Gregory Kucherov, Laurent Noé, Mikhaïl Roytberg LORIA (Nancy) 9-10 décembre 2004, Lille AS Indexation.

Présentations similaires


Présentation au sujet: "Sensibilité de graines espacées du type Subset seed Gregory Kucherov, Laurent Noé, Mikhaïl Roytberg LORIA (Nancy) 9-10 décembre 2004, Lille AS Indexation."— Transcription de la présentation:

1 Sensibilité de graines espacées du type Subset seed Gregory Kucherov, Laurent Noé, Mikhaïl Roytberg LORIA (Nancy) 9-10 décembre 2004, Lille AS Indexation de texte et découverte de motifs

2 2 Plan La problématique –Lalignement de séquences : heuristiques à laide de graines –Modèles de graines : Graines Espacées, Graines à transitions Sensibilité des graines : –Algorithme de Programmation Dynamique –Automate associé –Extension proposée Expérimentations –Automate et ses propriétés –programme Hedera

3 3 Pourquoi sintéresser aux méthodes dalignement local Oui, pourquoi ? #séquences, #utilisateurs, ( budget ) Programmation Dynamique (Smith-Waterman) –Donne une solution exacte –Coût quadratique (Optimisation en [Crochemore et al 02]) Méthodes Heuristiques –Fasta, Blast, PatternHunter, Blastz, Yass,… En pratique

4 4 Dot plot ctcgactcgggctcacgctcgcaccgggttacagcggtcgattgct aggcctcgggctcgcgctcgcgcgctagacaccgggttacagcgt Alignement détecté Filtrage à laide de graines Rechercher de courts fragments de texte conservés (graines). Puis Étendre ces graines de manière à former des alignements Graines détectées

5 5 Graines contiguës similarité exacte : motif de graine : Graine Contiguë Exemple : ATCAGT |||||| ATCAGT ###### ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA

6 6 ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA Graines espacées [Ma et al. 02: PATTERNHUNTER] Motif de graine : ###--#-## # : position dun match(accepte uniquement un | ) - : position dun joker(accepte tout : | :. ) Poids : 6[nombre de #] Étendue : 9[longueur totale] Exemple : ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA

7 7 Un exemple à titre illustratif ATCAGTGCAATGCTCAAGA ||||||||||||||||||| ATCAGTGCAATGCTCAAGA ###--#-## ATCAGTGCAATGCTCAAGA ||||||||||||||||||| ATCAGTGCAATGCTCAAGA ###### ATCAGTGCAATGCTCAAGA ||||||||||||||||||| ATCAGTGCAATGCTCAAGA ###--#-## ATCAGTGCAATGCTCAAGA ||||||||||||||||||| ATCAGTGCAATGCTCAAGA ###### ATCAGTGCAATGCTCAAGA ||||||||||||||||||| ATCAGTGCAATGCTCAAGA ###--#-## ATCAGTGCAATGCTCAAGA ||||||||||||||||||| ATCAGTGCAATGCTCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.||||||||||||| ATCAGCGCAATGCTCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||||||||||||| ATCAGCGCAATGCTCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.||||||||||||| ATCAGCGCAATGCTCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||||||||||||| ATCAGCGCAATGCTCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.||||||||||||| ATCAGCGCAATGCTCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||||||||||||| ATCAGCGCAATGCTCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.||||||||||||| ATCAGCGCAATGCTCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||||||||||||| ATCAGCGCAATGCTCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.|||||||:||||| ATCAGCGCAATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.|||||||:||||| ATCAGCGCAATGCGCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.|||||||:||||| ATCAGCGCAATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.|||||||:||||| ATCAGCGCAATGCGCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.|||||||:||||| ATCAGCGCAATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.|||||||:||||| ATCAGCGCAATGCGCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.|||||||:||||| ATCAGCGCAATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.|||||||:||||| ATCAGCGCAATGCGCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###### ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###### ###### ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###### ###### ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###--#-## ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ###### ######

8 8 Graines espacées Les graines espacées sont plus sensibles que les graines contiguës. Possibilité détendre le modèle des graines espacées, en prenant en compte les familles de mutations.

9 9 Propriétés Biologiques Transitions sont souvent sur-représentées. Phénomène de régularité dans les séquences codantes. Utiliser ces propriétés pour étendre le modèle des graines espacées. ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA Mutations sur lADN AT GC transitions transversions. : ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA

10 10 modèle de YASS: Graines à Transitions Motif de graine : # : position dun match - : position dun : position dun élément autorisant des : élément autorisant des transitions : accepte |,. ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA

11 11 Graines espacées Graines à transitions Problème : le choix du motif. ( pourquoi et pas ?) Le choix nest pas aléatoire Il faut: 1.Définir un modèle dalignement. 2.Rechercher la graine la plus sensible sur ce modèle calcul de la sensibilité Sensibilité : probabilité de détecter un alignement du modèle

12 12 1. Modèle dalignement Quest ce quun alignement Modèle dalignement: Modèle X sur lalphabet ou X = Bernoulli, Markov, HMM … ATCAGTGCAATGCTCAAGA |||||.||.||||:||||| ATCAGCGCGATGCGCAAGA |||||.||.||||:||||| modèle match/mismatch 11111h11h modèle match/tr./tv.

13 13 2. Calcul de la sensibilité dune graine Algorithme de programmation dynamique. Représenter une graine par un automate : graine expression régulière R automate reconnaissant Calculer la probabilité datteindre létat final sous le modèle X. [Motifs Statistics, Nicodème et al.] π = #-#-#

14 14 Méthode proposé par Buhler Exemple : –Reconnaître les mots détectés par la graine #-#-# (automate de Aho-Corasick) [Designing Seeds for Similarity Search in Genomic DNA, Buhler et al.]

15 15 Méthode proposé par Buhler Exemple : –Ne pas oublier les liens préfixes (AC : fonction bord ou fail) #-#-#

16 16 Méthode proposé par Buhler Exemple : –Fusion des états finaux #-#-#

17 17 Méthode proposé par Buhler Exemple : –Fusion des états finaux #-#-#

18 18 Méthode proposé par Buhler Exemple : –On obtient un automate qui accepte tous les alignements que la graine détecte. #-#-#

19 Méthode proposé par Buhler Calcul de la sensibilité : Algorithme de programmation dynamique Probabilité datteindre létat E lors de la lecture du i éme caractère –Dépend de la probabilité datteindre létat D 1, D 2,ou D 3 lors de létape i-1. –Dépend de la probabilité de générer le caractère 0 dans le modèle dalignement. E D1D1 D2D2 D3D3

20 20 Méthode proposé par Buhler Taille de lautomate construit : Exponentielle En pratique, la minimisation de Hopcroft est appliquée avant le calcul de la sensibilité. Et pour des graines à transitions ?? #-#-# w = nombre de # l = étendue de la graine

21 21 Et pour les graines à transitions On pourrait adopter le même principe: 0,h0,h 0,h0,h h 0 h 0 0 h0,h0,h 1 h 1 h h

22 22 Et pour les graines à transitions Taille de lautomate construit : Exponentielle avec Les graines à transitions: lautomate explose til vraiment ? se placer dans le cadre plus général des Subset Seeds… w = nombre de # l = étendue de la graine

23 23 Graines de type Subset Seeds Modèle des Subset Seeds Alphabet des alignements Alphabet des graines Exemple : graines à transitions { match, transition, transversion }

24 24 Graines de type Subset Seeds Il est possible dobtenir une construction dautomate en temps et en espace : La base ne dépend plus de la taille de lalphabet Cet automate sera de taille à celui de AC, et ce, même dans le cadre des graines espacées classiques w : nombre de # l : étendue de la graine

25 25 101h111h Automate des Subset seeds Information nécessaire : –Pour un alignement donne, quels sont les préfixes de π qui détectent cet alignement ? Restrictions –Se restreindre aux séquences ne terminant pas par 1 –Se restreindre aux préfixes ne terminant pas par # Cet ensemble de préfixes restreint sera appelé π : 101h111h # 101h111h #

26 26 Définition de lautomate Définition des états Q – : ensemble des préfixes restreints qui détectent lalignement courant – : longueur du plus grand suffixe ayant la forme 1 t Etats finaux –Etats tels que 101h111h 101h111h h111h11 π : 101h111h # 101h111h11 t q

27 27 Définition de lautomate 101h111h π : 101h111h h111h h111h1h 101h111h1h 101h111h1h 101h111h1h –si a = 1 alors le préfixe 1 t est étendu –Sinon X est la remise à jour des préfixes X après lecture de 1 t a Définition de la fonction de transition

28 28 Un exemple: –États Q π : avec RπRπ

29 29 X = {Ø} t = 0 X = {Ø} t = 1 X = {Ø} t = 2 X = {Ø} t = 3 X = {2} t = 0 X = {2} t = 1 X = {2,3} t = 0 X = {3} t = 0 F avec h 0,h0,h 0 0, h h 0 h 0 0,h0,h π :

30 30 Expérimentations Comparaison –Automate de Aho-Corasick –Automate présenté (Automate des Subset Seeds) –Comparaison avec lautomate minimisé

31 31 Comparaisons : 1) Cas des graines à transitions

32 32 Comparaisons: 2) Cas des graines espacées

33 33 Programme Hedera Le programme Calcul de la sensibilité de graines à transitions Bientôt en ligne …

34 34 Conclusion Concept de graines du type Subset Seed –généralisation du modèle de graines à transitions de YASS –extension possible pour les protéines Construction de lautomate –Automate compact et rapide à construire Algorithme de calcul de la sensibilité …

35 35 Questions … ? ? ? ? ?

36 36


Télécharger ppt "Sensibilité de graines espacées du type Subset seed Gregory Kucherov, Laurent Noé, Mikhaïl Roytberg LORIA (Nancy) 9-10 décembre 2004, Lille AS Indexation."

Présentations similaires


Annonces Google