La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Graphes k-partis et conception de circuits VLSI Pierre Fouilhoux Maitre de Conférences Université Pierre et Marie Curie - LIP6 Directeur: A. Ridha Mahjoub.

Présentations similaires


Présentation au sujet: "Graphes k-partis et conception de circuits VLSI Pierre Fouilhoux Maitre de Conférences Université Pierre et Marie Curie - LIP6 Directeur: A. Ridha Mahjoub."— Transcription de la présentation:

1 Graphes k-partis et conception de circuits VLSI Pierre Fouilhoux Maitre de Conférences Université Pierre et Marie Curie - LIP6 Directeur: A. Ridha Mahjoub Université Blaise Pascal - LIMOS Ecole Doctorale Sciences pour lIngénieur

2 Trouver un meilleur élément dans un ensemble fini valué Optimisation Combinatoire

3 Placement démetteurs hertziens

4 Optimisation Combinatoire Placement démetteurs hertziens

5 Optimisation Combinatoire Problème du Voyageur de commerce

6 Optimisation Combinatoire Problème du Voyageur de commerce

7 Optimisation Combinatoire Conception de circuits intégrés (VLSI) Composant Réseau Points terminaux

8 Optimisation Combinatoire Conception de circuits intégrés (VLSI)

9 Optimisation Combinatoire Reconstruction du génome T T C A G T T C A G

10 T T C A G Optimisation Combinatoire Recherche Opérationnelle Théorie des Graphes

11 T T C A G Optimisation Combinatoire Recherche Opérationnelle Stable dans un graphe = Sommets isolés

12 T T C A G Théorie des Graphes Optimisation Combinatoire Recherche Opérationnelle Stable dans un graphe

13 T T C A G Théorie des Graphes Optimisation Combinatoire Recherche Opérationnelle k-partition dans un graphe

14 T T C A G Théorie des Graphes Optimisation Combinatoire Recherche Opérationnelle

15 T T C A G Théorie des Graphes Optimisation Combinatoire Recherche Opérationnelle bipartition dans un graphe (k=2) C

16 T T C A G Théorie des Graphes Optimisation Combinatoire Recherche Opérationnelle bipartition dans un graphe (k=2) C

17 T T C A G Optimisation Combinatoire Recherche Opérationnelle Théorie des Graphes

18 P B (G)=conv { x W | W V, (W,E(W)) est biparti } T T C A G Optimisation Combinatoire Recherche Opérationnelle Programmation mathématique Approches polyédrales Théorie des Graphes

19 T T C A G T T C A G Polymorphisme génétique SNP : Single Nucleotide Polymorphism Reconstituer les 2 haplotypes et les SNP ATCGATGCATGAATGCATGCA ATCGATGGATGTATGCAAGCA Organismes diploïdes T A Assemblage SNP dhaplotypes Molécule dADN 2 haplotypes

20 f 1 ATCGATGCATGA f 2 TCGATGGAT G AAT f 3 ATGCAT G TAT G CAA f 4 ATGAATGCAT G CA f 5 CATGCA Fragments f i f 1 ATCGATGCATGA f 2 TCGATGGAT G AAT f 3 ATGCATGTAT G CAA f 4 ATGAATGCAT G CA f 5 CATGCA Détection des SNP f 1 ATCGATGCATGA f 2 TCGATGGAT G AAT f 3 ATGCAT G TAT G CAA f 4 ATGAATGCAT G CA f 5 CATGCA SNP s j S1S1 S2S2 S3S3 Assemblage SNP dhaplotypes Objectif Reconstituer les deux haplotypes f1f1 f2f2 f5f5 f4f4 f3f3 H1H1 H2H2

21 Enlèvement minimal de fragments f1f1 f2f2 f5f5 f4f4 f3f3 Problème de bipartisation de graphe Lippert, Schwartz, Lancia, Istrail (2001) Assemblage SNP dhaplotypes est équivalent au f3f3 f 1 ATCGATGCATGA f 2 TCGATGGAT G AAT f 3 ATGCAT G TAT G CAA f 4 ATGAATGCAT G CA f 5 CATGCA S1S1 S2S2 S3S3 f2f2 f1f1 f4f4 f5f5 fjfj fifi Haplotype 1 Haplotype 2

22 Résolution informatique du problème de bipartisation v1v1 v2v2 v3v3 v4v4 v5v5 v7v7 v8v8 v9v9 v 10 v6v6

23 v1v1 v2v2 v3v3 v4v4 v5v5 v7v7 v8v8 v9v9 v6v6 Résolution informatique du problème de bipartisation

24 v1v1 v2v2 v3v3 v4v4 v5v5 v7v7 v8v8 v9v9 v 10 v6v6 v 1 v 2 v 3 v 4 v 5 v 6 v 7 v 8 v 9 v Résolution informatique du problème de bipartisation vivi conservé ôté 1 0

25 v1v1 v2v2 v3v3 v4v4 v5v5 v7v7 v8v8 v9v9 v 10 v6v6 v 1 v 2 v 3 v 4 v 5 v 6 v 7 v 8 v 9 v Résolution informatique du problème de bipartisation Ce nest pas une solution vivi conservé ôté 1 0 C

26 v1v1 v2v2 v3v3 v4v4 v5v5 v7v7 v8v8 v9v9 v 10 v6v6 v 1 v 2 v 3 v 4 v 5 v 6 v 7 v 8 v 9 v Résolution informatique du problème de bipartisation Cest une solution vivi conservé ôté 1 0

27 Résolution informatique du problème de bipartisation Une première idée: Enumération de toutes les solutions n2n2n Temps de calcul Blue Gene Ordinateur du futur ,00000…1 seconde… milliardième de sec… 501,26 million de milliards16 minutesquelques sec milliards de milliards de milliards 1,1 milliard dannées 1 milliard dannées …… n sommets 2 n =2 x 2 x … x 2 solutions à énumérer n fois

28 Soit G=(V,E) un graphe c un vecteur-poids sur les sommets de V. Pour B V, on pose Formulation en un programme linéaire en nombres entiers Formulation mathématique: Approche polyèdrale et algorithme de coupes

29 Formulation mathématique: Approche polyèdrale et algorithme de coupes v1v1 v2v2 v3v3 (0,0,0) (1,0,0) (0,1,0) (0,0,1) (1,1,0) (1,0,1) (0,1,1) (1,1,1)

30 Formulation mathématique: Approche polyèdrale et algorithme de coupes (0,1,0)(1,1,0) (1,0,0) (1,0,1)(0,0,1) (0,1,1) (0,0,0) (1,1,1) v1v1 v2v2 v3v3 On associe à chaque solution un point saillant dun (hyper)-cube

31 Formulation mathématique: Approche polyèdrale et algorithme de coupes (0,1,0)(1,1,0) (1,0,0) (1,0,1)(0,0,1) (0,1,1) v1v1 v2v2 v3v3 On associe à chaque solution un point saillant dun (hyper)-cube (0,0,0) (1,1,1)

32 Formulation mathématique: Approche polyèdrale et algorithme de coupes (0,1,0)(1,1,0) (1,0,0) (1,0,1)(0,0,1) (0,1,1) v1v1 v2v2 v3v3 On associe à chaque solution un point saillant dun (hyper)-cube (0,0,0)

33 Formulation mathématique: Approche polyèdrale et algorithme de coupes P B (G)=conv { x W | W V, (W,E(W)) est biparti }

34 Complexité des problèmes On dit que ces problèmes sont faciles ou polynomiaux dans P et les autres problèmes sont donc dans Non-P On ne sait pas dire si de nombreux problèmes célèbres sont dans P ou dans Non-P P=NP ? Est-ce que ce problème de bipartisation est difficile ou non? Cest la classe des problèmes dont on peut facilement savoir si une solution quelconque est valide ou non valide. La classe de problème la plus célèbre est la Classe NP (Non-Deterministic Polynomial)

35 Croisement Circuit électronique Ensemble de composants avec un ou plusieurs points terminaux reliés par des pistes rassemblées en réseaux. Croisement Deux pistes de réseaux différents qui se croisent doivent être affectées à des couches différentes dans le but déviter les connexions interdites. Problème de Via Minimization

36 Fil sur couche A B Une affectation valide est une affectation des pistes sur les couches de manière à ce que deux pistes de réseaux différents qui se croisent, soient sur des couches différentes. Via Trou à percer pour connecter deux pistes dun même réseau. Problème de Via Minimization

37 Le problème de Via Minimization contraint Déterminer une affectation valide des segments de pistes sur les couches avec un nombre minimum de vias sans déplacer les pistes. Problème de Via Minimization

38 Pour tout cycle impair C de G. Un via doit être percé à lemplacement correspondant à un des sommets du cycle impair C. C Problème de Via Minimization

39 Pour tout cycle impair C de G. Un via doit être percé à lemplacement correspondant à un des sommets du cycle impair C. C Problème de Via Minimization

40 Pour tout cycle impair C de G. Un via doit être percé à lemplacement correspondant à un des sommets du cycle impair C. C Problème de Via Minimization

41 Le problème de Via Minimization sur 2 couches Le problème du sous-graphe biparti induit Problème de Via Minimization est équivalent au

42 328 vias 88 réseaux 1695 croisements Temps de calcul 7min50 nb coupes 7551 nb sommets 6579 Problème de Via Minimization

43 729 réseaux croisements nb sommets nb coupes Temps de calcul 4h vias Problème de Via Minimization

44 Conclusion Modélisation dun problème de séquençage des génomes diploïdes Modélisation du problème de Via Minimization Etude polyédrale du problème de bipartisation de graphe Elaboration de logiciels de résolution pour le problème de génomique et délectronique.


Télécharger ppt "Graphes k-partis et conception de circuits VLSI Pierre Fouilhoux Maitre de Conférences Université Pierre et Marie Curie - LIP6 Directeur: A. Ridha Mahjoub."

Présentations similaires


Annonces Google