La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Institut de Génétique et Microbiologie LES CRISPRS, INSTRUMENTS D'ETUDE DE L'EVOLUTION INTER ET INTRA- SPÉCIFIQUE CHEZ LES MICROORGANISMES Soutenance de.

Présentations similaires


Présentation au sujet: "Institut de Génétique et Microbiologie LES CRISPRS, INSTRUMENTS D'ETUDE DE L'EVOLUTION INTER ET INTRA- SPÉCIFIQUE CHEZ LES MICROORGANISMES Soutenance de."— Transcription de la présentation:

1 Institut de Génétique et Microbiologie LES CRISPRS, INSTRUMENTS D'ETUDE DE L'EVOLUTION INTER ET INTRA- SPÉCIFIQUE CHEZ LES MICROORGANISMES Soutenance de thèse, le 24 Juin 2008, IGM Ibtissem GRISSA

2 Introduction Résultats Discussion Perspectives 2 PLAN Introduction : Les CRISPRs avant 2006 Etat des lieux But de la thèse Résultats Investigation des CRISPRs Le CRISPR pour la phylogénie Discussion Investigations du CRISPR Utilisation du CRISPR pour la phylogénie Perspectives Les metagenomes Introduction : Les CRISPRs avant 2006 Etat des lieux But de la thèse Résultats Investigation des CRISPRs Le CRISPR pour la phylogénie Discussion Investigations du CRISPR Utilisation du CRISPR pour la phylogénie Perspectives Améliorer les outils Les métagénomes Introduction Résultats Discussion Perspectives

3 Introduction Résultats Discussion Perspectives 3 DR Leader spacers DR dégénéré TTAGGGTTACGTCCCCCCCGATTCTTGTGACCCTCTTTTTATCACTATGACTAACGTATTGATTTTTATGCTACTCAGGTATT TCACTAAAAAAAGGGTTTTTACGCATTTTGCGCCATTGCTCATTGATAAACATCGGGTTATCCGTATTATCTTACGTTCAC TGCCGCACAGGCAGCTTAGAAAATGTTCGACGATTTATTTTATTTGTATTTCAGGTTCACTGCCGCACAGGCAGCTTA GAAAATTTATTAAAGATGCTGACAAAAAGAACTTAAGTTCACTGCCGCACAGGCAGCTTAGAAAGTCAACGCTTCAC TCCCTGCGCGGGGTATAACGTTCACTGCCGCACAGGCAGCCCAATAA Yersinia pestis CO92 (NC_003143_2 ) 1 ère observation : Escherichia coli (Ishino 1987) succession de séquences répétées de 29pb espacées de séquences uniques de 32-33pb. 2 locus séparés de 24 kb (14 et 7 répétitions) Introduction La découverte des CRISPRs (1)

4 Introduction Résultats Discussion Perspectives : découverte dun CRISPR dans le complexe Mycobacterium tuberculosis Introduction Structure présente chez tous les membres du complexe M. tuberculosis Marqueur génétique assez polymorphe pour différencier les souches 1996 : Le spoligotypage pour le typage épidémiologique de M. tuberculosis (Membrane doligonuclétides composée de 43 spacers) La découverte des CRISPRs (2) Obeservations chez les archées : 2 Haloferax volcanii et H. mediterranei (Mojica et col. 1993, 1995) Sulfolobus (She 1994)

5 Introduction Résultats Discussion Perspectives 5 Lacronyme CRISPR TREP Tandem Repeat SRSR Short Regularly Spaced Repeats DVR Direct Variable Repeat LCTR Long Cluster of Tandem Repeat SPIDR Spacers Interspaced Direct Repeats E. coli DR : 29bp, spacer : 32-33pb CGGTTTATCCCCGCTGGCGCGGGGAACTC H. mediterranei et H. volcanii DR : 30bp, spacer : 33-39pb GTTACAGACGAACCCTAGTTGGGTTGAAGC M. tuberculosis DR : 36pb spacer : 35-41pb GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC CRISPR Clustered Regularly Interspaced Short Palindromic Repeat Jansen 2002 Introduction

6 Résultats Discussion Perspectives 6 Un groupe de gènes associés DR Leader spacers DR dégénéré gènes cas Le système CASS : CRISPR + cas Jansen 2002 cas1 : réparation de lADN cas2 : transposase cas3 : hélicase cas4 : recB exonuclease Makarova gènes impliqués dans la réparation de lADN Etude phylogénétique des gènes cas Présence du même DR chez des espèces éloignées Transfert horizontal Introduction

7 Résultats Discussion Perspectives 7 Tang et col. PNAS 2002 Identification of 86 candidates for small non-messenger RNAs from the archeon Archaeoglobus fulgidus. Introduction Transcription du locus CRISPR

8 Introduction Résultats Discussion Perspectives 8 Origine des spacers Acquisition du spacer à partir déléments génétiques préexistants dorigine extrachromosomique (phages, plasmides) ou chromosomique Génomes analysés Spacers analysés Spacers reconnus phagesplasmideschromosome (2%)47 (54%)10 (11%)31 (35%) (Mojica 2005) 2005 : origine des spacers et suggestions sur le rôle du CRISPR Mojica 2005 Pourcel 2005Bolotin procaryotes Streptococcus thermophilus S. vestibularis Yersinia pestis Y. pseudotuberculosis Streptococcus pyogenes Corrélation avec la résistance aux phages Hypothèse : Le CRISPR est un système immunitaire chez les procaryotes utilisant linterférence ARN Introduction

9 Résultats Discussion Perspectives 9 Un système de résistance par interférence ARN sp4 Leader DR sp2sp3sp1 ADN invasif Cas Dégradation du phage phage Protéines Cas sRNA Cas ARN Transcription Modèle daction du CRISPR Introduction

10 Résultats Discussion Perspectives 10 Evolution de la structure CRISPR Acquisition polarisée adjacente à la séquence leader Perte interstitielle de spacers Les spacers communs renseignent sur un ancêtre commun Le polymorphisme des spacers est un indicateur phylogénétique DR sp2sp3 Leader sp1 sp4 Leader ADN invasif DR sp2sp3sp1 + + = Cas Introduction

11 Résultats Discussion Perspectives 11 Problématique Comprendre lorganisation de la structure CRISPR Comprendre lorigine et le rôle du CRISPR Comprendre le fonctionnement du CRISPR et son parcours évolutif Outil de génotypage : le CRISPR comme marqueur de microévolution? Transfert horizontal : détermination de la structure minimale transposée chez différentes bactéries Transposition des CRISPRs et des séquences adjacentes sur le même génome Introduction Outils informatiques pour faciliter lexploration, la compréhension et lutilisation des CRISPRs

12 Introduction Résultats Discussion Perspectives 12 PLAN Introduction : Les CRISPRs avant 2006 Etat des lieux jusquà fin 2005 But de la thèse Résultats Investigation des CRISPRs Le CRISPR pour la phylogénie Discussion Investigations du CRISPR Utilisation du CRISPR pour la phylogénie Perspectives Les metagenomes Introduction : Les CRISPRs avant 2006 Etat des lieux But de la thèse Résultats Investigation des CRISPRs Le CRISPR pour la phylogénie Discussion Investigations du CRISPR Utilisation du CRISPR pour la phylogénie Perspectives Les metagenomes Résultats

13 Introduction Résultats Discussion Perspectives 13 Outils informatiques créés Analyse systématique de tous les CRISPRs des génomes séquencés Analyse systématique de tous les CRISPRs des génomes séquencés Utilisation du CRISPR pour la phylogénie intra-espèce Utilisation du CRISPR pour la phylogénie intra-espèce Créer une base de données Analyser les séquences flanquantes Stocker les DR Stocker les spacers (tronçons de virus) Effectuer des BLAST CRISPRdb Analyse de la microévolution Comparaison des CRISPRs Identifier les spacers Construire un catalogue par espèce CRISPRcompar Données Gold Oct génomes complets 804 procaryotes en cours Introduction Identifier les CRISPRs

14 Introduction Résultats Discussion Perspectives 14 Les programmes utilisés Patscan p1= p1 Consensus pattern (60 bp): GTGTTCCCCGCGCATCGCGGGGGTTGAAGGGTCAGGTCTGCATCAACGATCGCCCACTCC TRF Repeat size Start position Programmes non spécifiques aux CRISPRs Besoin de traitement manuel supplémentaire Besoin dautomatisation Définition des limites du DR REPuter Résultats

15 Introduction Résultats Discussion Perspectives 15 Création de CRISPRFinder CRISPRFinder AA acbd Utilisation de Vmatch (Reputer) -Liste des répétitions maximales ayant une taille bien définie, séparées par des séquences de taille prédéfinie Résultats

16 Introduction Résultats Discussion Perspectives 16 Les bornes du DR: DR consensus CRISPRFinder : difficultés (1) 29 pb Y. pestis C092 Positions : ! La taille des spacers Clostridium botulinum A3 Positions : pb Entre 21 et 37 pb Résultats

17 Introduction Résultats Discussion Perspectives 17 CRISPRFinder : difficultés (2) 1 AGGTTTTGCTGCCTTTTCGGCGGGTATC TCAAAGTCAACTTGTAAATGACGATTTTCACG 32 2 ATTTTCAGCTGCCTATTCGGCAGGTCAC AGTTTGGGGCTGAGTTTGCCATTTTCCTAAAT 32 3 ATTTTCAGCTGCCTATTCGGCAGGTCAC GATGAAGCAGACCACCTCGATTACCCCACGCT 32 4 ATTTTCAGCTGCCTATTCGGCAGGTCAC ACTATTTATCAAGACCTTCTTTAAAATCAAAC 32 5 ATTTTCAGCTGCCTATTCGGCAGGTCAC AGTTTGGGGCTGAGTTTGCCATTTTCCTAAAC 32 6 ATTTTCAGCTGCCTATTCGGCAGGTCAC ( ) ( ) ** ** * * ** Shewanella sp. ANA-3 (CRISPR_2) Yersinia pestis KIM (CRISPR_4) 1 TTATTGGGCTGCCTGTGCGGCAGTGAAC GTTATACCCCGCGCAGGGAGTGAAGCGTTGAC 32 2 TTTCTAAGCTGCCTGTGCGGCAGTGAAC TTAAGTTCTTTTTGTCAGCATCTTTAATAAAT 32 3 TTTCTAAGCTGCCTGTGCGGCAGTGAAC CTGAAATACAAATAAAATAAATCGTCGAACAT 32 4 TTTCTAAGCTGCCTGTGCGGCAGTGAAC ( ) ( ) ** ** Sulfolobus tokodaii str. 7 (CRISPR_2) 7 GATGAATCCCAAAAGGAATTGAAAG TGATTGATCACAATGAGAAGACTGTAAAGCTGATAAAC 38 8 GATGAATCCCAAAAGGAATTGAAAG TGTTGAGGCATAAATTAATCTATCCTTAATGAAAAAT 37 9 GATGAATCCCAAAAGGAATTGAAAG TTCTTCCTCAGCCTCCATTTTGTTTATGATTTGTAGTGCC GATGAATCCCAAAAGGAATTGAAAG TTCAATAATCTCTATCTTTCCAAAATCTGTAAATGAAGAC GATGAATCCCAAAAGGAATTGAAAG AAAGCACAGTCAATAACGTTATCTGGTATCATATTATCAAA GATGAATCCCAAAAGGAATTGAAAG CTTTCTCCTTCCCTCTGATCTCTCGCTGAATTGAAAAGA GATGAATCCCAAAAGGAATTGAAAG GTAAGTATTGATGCTAACATTGACTTCGCTGTCCCAGGGGC GATGAATCCCAAAAGGAATTGAAGG AAGTATAATAACGATAGTACTAAAATTAATTGATCC GATGATTCTCAAAAGGAATTGATAA * * *** (32702) (39896) Le DR dégénéré Résultats

18 Introduction Résultats Discussion Perspectives 18 CRISPRFinder : difficultés (3) Aquifex aeolicus VF5 NC_000818_6, positions : Alignement des leader Les petits CRISPRs Résultats

19 Introduction Résultats Discussion Perspectives 19 Les grandes étapes de CRISPRFinder Sequence(s) Localisations possibles DR 23bp - 55bp 25bp - 60bp DR 23bp - 55bp [ 0.6DR - 2.5DR ] DR [, ] Vérification de la structure Elimination des Répétitions en tandem Identification des DR candidats CRISPRs putatifs CRISPRs confirmés ? Vérification des DR aux extrémités Répétition maximale Résultats

20 Introduction Résultats Discussion Perspectives 20 Création de la base CRISPRdb Filtres ajoutés pour la base Télécharger les génomes complets sur le site NCBI ftp://ftp.ncbi.nih.gov/genomes/Bacteria Vérification manuelle Appliquer CRISPRFinder Blast des DR et vérification de la terminaison Vérification de la taille des DR et spacers Filtres sur les CRISPRs putatifs Validation Résultats

21 Introduction Résultats Discussion Perspectives 21 Bilan CRISPRdb Mise à jour du 05/06/2008 Des CRISPRs de un à presque 300 motifs de long (moyenne : 23) (22 pour les bactéries et 27 pour les archées) Une espèce peut posséder jusquà 20 CRISPRs (Methanocaldococcus jannaschii) 2 ou plusieurs CRISPRs de DR identiques ou différents Les CRISPRs constituent presque 1% du génome qui les portent (1,1% chez Sulfolobus tokodaii ) Les souches dune même espèce ne partagent pas toujours les mêmes CRISPRs Résultats

22 Introduction Résultats Discussion Perspectives 22 PLAN Introduction : Les CRISPRs avant 2006 Etat des lieux jusquà fin 2005 But de la thèse Résultats Investigation des CRISPRs Le CRISPR pour la phylogénie Discussion Investigations du CRISPR Utilisation du CRISPR pour la phylogénie Perspectives Les metagenomes Introduction : Les CRISPRs avant 2006 Etat des lieux jusquà fin 2005 But de la thèse Résultats Investigation des CRISPRs Le CRISPR pour la phylogénie Discussion Investigations du CRISPR Utilisation du CRISPR pour la phylogénie Perspectives Améliorer les outils Les métagénomes Résultats

23 Introduction Résultats Discussion Perspectives 23 Le CRISPR pour la phylogénie intra-espèce Mécanisme dévolution par délétion ou par insertion polarisée Analyse de multiples allèles de différentes souches pour un locus CRISPR donné Lorsque lespèce contient un ou plusieurs CRISPRs Lorsque le CRISPR présente un polymorphisme intra- espèce important Espèces jeunes ( Y. pestis, M. tuberculosis ) ou complexes clonaux ( Pseudomonas aeruginosa ) contrairement aux espèces plus anciennes ( Y. pseudotuberculosis, M. canetti ) Résultats

24 Introduction Résultats Discussion Perspectives 24 Investigations (1) Identification dun (plusieurs) CRISPRs Consultation de la base CRISPRdb Utilisation de CRISPRFinder Quantifier le polymorphisme du CRISPR Utilisation de CRISPRcomparison MyCRISPRdb Résultats

25 Introduction Résultats Discussion Perspectives 25 Investigations (3) Choisir les amorces PCR : 20-30pb à 40 pb du CRISPR Flankalign CRISPRcomparison sp4 Leader DR sp2sp3sp1 F1R1 R2 Résultats Manipulations techniques sur une collection représentative dune espèce (amplification PCR et séquençage)

26 Introduction Résultats Discussion Perspectives 26 Analyse des données (1) Constituer un catalogue de spacers Résultats

27 Introduction Résultats Discussion Perspectives 27 Analyse des données (2) TableCodedAlleles Fichier binaire Organisation des locus CRISPR dans six souches Y. pestis Fichiers de sortie Résultats

28 Introduction Résultats Discussion Perspectives 28 PLAN Introduction : Les CRISPRs avant 2006 Etat des lieux jusquà fin 2005 But de la thèse Résultats Investigation des CRISPRs Le CRISPR pour la phylogénie Discussion Investigations du CRISPR Utilisation du CRISPR pour la phylogénie Perspectives Les metagenomes Introduction : Les CRISPRs avant 2006 Etat des lieux jusquà fin 2005 But de la thèse Résultats Investigation des CRISPRs Le CRISPR pour la phylogénie Discussion Investigations du CRISPR Utilisation du CRISPR pour la phylogénie Perspectives Améliorations des outils Les métagénomes Discussion

29 Introduction Résultats Discussion Perspectives 29 Comparaison de PILER-CR, CRT et CRISPRFinder PILER-CR Rapidité Peu de faux positifs CRT Rapidité Trouver le DR dégénéré Définition du DR consensus Mais DR dégénéré DR consensus Petits CRISPRs Faux positifs Chevauchement de CRISPRs Plusieurs propositions Petits CRISPRs Discussion

30 Introduction Résultats Discussion Perspectives 30 Comparaison de PILER-CR, CRT et CRISPRFinder Streptococcus sanguinis SK36, PILER-CRCRT NON Oui, mais NON Discussion

31 Introduction Résultats Discussion Perspectives 31 Problématique Comprendre lorganisation de la structure CRISPR Comprendre lorigine et le rôle du CRISPR Comprendre le fonctionnement du CRISPR et son parcours évolutif Outil de génotypage : le CRISPR comme marqueur de microévolution? Transfert horizontal : détermination de la structure minimale transposée chez différentes bactéries Transposition des CRISPRs et des séquences adjacentes sur le même génome Discussion

32 Introduction Résultats Discussion Perspectives 32 Organisation du CRISPR (1) Structure secondaire (kunin 2008) Clustering des DR (12 groupes) (kunin 2008, Horvath 2008) DR Le DR : EspècetailleDR Bacteroides fragilis47GCTGTTTCCAATGGTTCAAAGATACTAATTTGAAAGCAAATCACAAC Streptococcus pyogenes36GTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAAC Mycobacterium tuberculosis 36GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC Escherichia coli29CGGTTTATCCCCGCTGGCGCGGGGAACTC Yersinia pestis28GTTCACTGCCGCACAGGCAGCTTAGAAA Pyrobaculum aerophilum25CCAGAAATCAAAAGATAGTTGAAAC Thermotoga petrophila30GTTTCAATAGTTCCTTAGAGGTATGGAAAC Taille : 23-47pb, terminaison particulière : (C/G)AA(A)(G/C) Diversité dun CRISPR à lautre (533 DR distincts pour 873 CRISPRs) Conservation presque parfaite au sein dun même CRISPR Discussion

33 Introduction Résultats Discussion Perspectives 33 Organisation du CRISPR (1) DR Verminephrobacter eiseniae : 294 DRs exactement identiques Un système de maintenance de lintégrité du DR? Thermoproteus neutrophilus Discussion

34 Introduction Résultats Discussion Perspectives 34 Organisation du CRISPR (2) Taille constante ou variable Signature particulière sur le génome dorigine (proto- spacer) (Deveau 2008) Identification de virus à partir des spacers (Andersson, science 2008) Le même spacer sur deux CRISPRs différents du même génome ou chez des souches voisines Duplication ou acquisition indépendante dun spacer sur le même CRISPR (Horvath 2008) 417 spacers présents en deux copies parmi (< 2%) 89 souches parmi 712 (~13%) DR Les spacers : Methanothermobacter thermautotrophicusus Discussion

35 Introduction Résultats Discussion Perspectives 35 Problématique Comprendre lorganisation de la structure CRISPR Comprendre lorigine et le rôle du CRISPR Comprendre le fonctionnement du CRISPR et son parcours évolutif Outil de génotypage : le CRISPR comme marqueur de microévolution? Transfert horizontal : détermination de la structure minimale transposée chez différentes bactéries Transposition des CRISPRs et des séquences adjacentes sur le même génome Discussion

36 Introduction Résultats Discussion Perspectives 36 Démonstration du rôle du CRISPR Implication dans lacquisition dune résistance contre les phages (Barrangou et col., Science 2007), (Horvath 2008), (Devau 2008) Discussion Modèle interférence ARN chez les procaryotes (Makarova 2006) -Autre rôle? - Régulation de certains gènes?

37 Introduction Résultats Discussion Perspectives 37 Problématique Comprendre lorganisation de la structure CRISPR Comprendre lorigine et le rôle du CRISPR Comprendre le fonctionnement du CRISPR et son parcours évolutif Outil de génotypage : le CRISPR comme marqueur de microévolution? Transfert horizontal : détermination de la structure minimale transposée Transposition des CRISPRs et des séquences adjacentes sur le même génome Discussion

38 Introduction Résultats Discussion Perspectives 38 Confirmation de lacquisition polarisée Le CRISPR NC_007503_3 de Carboxydothermus hydrogenoformans Z Le DR jaune + le leader chez NC_007503_3 et NC_007503_4 Acquisition polarisée : (lillestol 2006), (Barrangou 2007), (Horvath 2008), (Tyson& Banfield 2008), (Andersson 2008) Discussion Leader

39 Introduction Résultats Discussion Perspectives 39 Acquisition de nouveaux motifs sp4 Leader DRDR2 sp2 DR1 sp3 DR3 sp1 sp4 DR3 copie Leader DRDR2 sp2 DR1 sp3sp1 DRDR2 sp2 DR1 sp3sp1 DR3 sp4 DR3 copie DRDR2 sp2 DR1 sp3sp1 DR3 Comment le dernier motif est-il ajouté? ADN invasif DR3 copie Le DR adjacent au leader est le dernier DR acquis ou le premier DR acquis? sp4 Leader DRDR2 sp2 DR1 sp3sp1 Discussion

40 Introduction Résultats Discussion Perspectives 40 Problématique Comprendre lorganisation de la structure CRISPR Comprendre lorigine et le rôle du CRISPR Comprendre le fonctionnement du CRISPR et son parcours évolutif Outil de génotypage : le CRISPR comme marqueur de microévolution? Transfert horizontal : détermination de la structure minimale transposée chez différentes bactéries Transposition des CRISPRs et des séquences adjacentes sur le même génome Discussion

41 Introduction Résultats Discussion Perspectives 41 Le CRISPR comme marqueur phylogénétique Avantages: Facilité technique (PCR ou spoligotypage) Rapidité Importation et échangeabilité inter-laboratoires Limites: 60% des bactéries nont pas de CRISPR Acquisition indépendante du même spacer CRISPR non polymorphes ou absents (Lactobacillus casei ) CRISPR très polymorphe (Y. pseudotuberculosis, M. canettii) Bon outil de différenciation de souches + outil complémentaire pour étudier la micro-évolution Discussion

42 Introduction Résultats Discussion Perspectives 42 Problématique Comprendre lorganisation de la structure CRISPR Comprendre lorigine et le rôle du CRISPR Comprendre le fonctionnement du CRISPR et son parcours évolutif Outil de génotypage : le CRISPR comme marqueur de microévolution? Transfert horizontal : détermination de la structure minimale transposée chez différentes bactéries Transposition des CRISPRs et des séquences adjacentes sur le même génome Discussion

43 Introduction Résultats Discussion Perspectives 43 Même leader et même DR Transport à travers les plasmides (Godde 2007) Legionella pneumophila Lens Le même DR chez des espèces éloignées Discussion Transfert horizontal du CRISPR %GC différent du reste du génome (Horvath 2008)

44 Introduction Résultats Discussion Perspectives 44 Problématique Comprendre lorganisation de la structure CRISPR Comprendre lorigine et le rôle du CRISPR Comprendre le fonctionnement du CRISPR et son parcours évolutif Outil de génotypage : le CRISPR comme marqueur de microévolution? Transfert horizontal : détermination de la structure minimale transposée chez différentes bactéries Transposition des CRISPRs et des séquences adjacentes sur le même génome Discussion

45 Introduction Résultats Discussion Perspectives 45 Création dun nouveau CRISPR Les essaimages de CRISPRs Un seul groupe de gènes associés Le même DR (quelques déviations parfois) Spacers différents Hypothèse : structure minimale transposée formée dun leader et un DR DR Discussion

46 Introduction Résultats Discussion Perspectives 46 PLAN Introduction : Les CRISPRs avant 2006 Etat des lieux jusquà fin 2005 But de la thèse Résultats Investigation des CRISPRs Le CRISPR pour la phylogénie Discussion Investigations du CRISPR Utilisation du CRISPR pour la phylogénie Perspectives Améliorations des outils Les métagénomes Perspectives

47 Introduction Résultats Discussion Perspectives 47 Perspectives (1) Investigations des petits CRISPRs Confirmation des CRISPRs putatifs (blast DR, …) Vérifications manuelles? Recherche des gènes cas Recherche de proto spacer Epidémiologie, phylogénie (Projets en cours) Exploitation des données de métagénomes Explorer des génomes de lenvironnement (communautés multi-espèces) Nature des CRISPRs, statistiques, transfert horizontal… Exploration des phages pour chercher les proto-spacer et identifier leurs sites de reconnaissance Stockage des DR et des spacers avec possibilité de BLAST Perspectives

48 Introduction Résultats Discussion Perspectives 48 Perspectives (2) Diversité des DR : pb Nombre de motifs : jusquà plus de 250 motifs Perspectives

49 Institut de Génétique et Microbiologie LES CRISPRS, INSTRUMENTS D'ETUDE DE L'EVOLUTION INTER ET INTRA- SPÉCIFIQUE CHEZ LES MICROORGANISMES Soutenance de thèse, le 24 Juin 2008, IGM Ibtissem GRISSA


Télécharger ppt "Institut de Génétique et Microbiologie LES CRISPRS, INSTRUMENTS D'ETUDE DE L'EVOLUTION INTER ET INTRA- SPÉCIFIQUE CHEZ LES MICROORGANISMES Soutenance de."

Présentations similaires


Annonces Google