La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Projet Génome Humain (HGP). Plan 1 ère heure Génome Tailles des génomes Projet « Génome Humain » Technique Séquençage 2 ème heure Enjeux (discussion)

Présentations similaires

Présentation au sujet: "Projet Génome Humain (HGP). Plan 1 ère heure Génome Tailles des génomes Projet « Génome Humain » Technique Séquençage 2 ème heure Enjeux (discussion)"— Transcription de la présentation:

1 Projet Génome Humain (HGP)

2 Plan 1 ère heure Génome Tailles des génomes Projet « Génome Humain » Technique Séquençage 2 ème heure Enjeux (discussion)

3 Génome Définition : Ensemble du matériel génétique dun individu. Définition : Le génome est lensemble de lADN présent dans le noyau de chacune des cellules dun organisme.

4 Taille

5 Quelques génomes Organisme (Règne)Taille (pb)Gènes Bactériophage (Virus) 5 x10 4 ~ 60 E. coli (Bactérie)4,6 x10 6 ~ 4000 S. cerevisiae (Champignon)1,2 x10 7 ~ 6000 A. thaliana (Plante)1,2 x10 8 ~ 28000 H. sapiens (Animal)3,2 x10 9 ~ 25000

6 Projet « Génome Humain » But : Séquencer et annoter le génome humain. Coût : ~ 3000000000 $ en ~15 ans (~1$ par pb)

7 Projet « Génome Humain » Par qui ? Secteur public (Universités, etc) et Secteur privé (Celera)

8 Chronologie 1977 Méthode de séquençage de lADN 1985 Naissance du Projet 1990Création d HUGO. Début du séquençage 1996Carte génétique 1998Carte physique 1999Chromosome 22 terminé 2001Brouillon du génome (~90%) 2003>99% achevé. Lannotation continue…

9 Projet « Génome Humain » Contenant (matériel génétique) Séquence des chromosomes Contenu (informations) Gènes et régions fonctionnelles

10 Cellule Noyau Chromosome ADN Matériel génétique

11 Séquençage de lADN Définition : Technique permettant de déterminer la séquence (ordre des nucléotides) dune molécule dADN.

12 Séquençage selon Sanger Polymérisation de lADN 5ATGGCTATGCCGAGACCATATTACGACCAG 3 3TACCGATACGGCTCTGGTATAATGCTGGTC 5 Matrice A G T C C G A C G Polymérase Amorce Nucléotides (dNTP)

13 Didésoxyribo-nucléotides Désoxyribo-ntDidésoxyribo-nt 1 2 3 4 5

14 Séquençage selon Sanger Réaction de séquençage (ddGTP) 5ATGGCTATGCCGAG 3TACCGATACGGCTCTGGTATAATGCTGGTC 5 Matrice A G T C G C A C G Polymérase Amorce dNTP + ddGTP


16 Gel dAgarose Séquençage selon Sanger Séparation des produits 5ATGGCTATGCCGAG 5ATGGCTATGCCG 5ATGGCTATG Electrode - Electrode + Migration Electrophorèse

17 Séquençage selon Sanger Gel dAgarose Migration Electrode - Electrode + ddAddGddCddT AGGCTATCTGAC 5 3

18 Séquençage automatique Ordinateur

19 Séquençage, aujourdhui 600-800 nt. ~3 h. ~20.- CHF ~3 ctm/nt.

20 Comment séquencer 3,2 Gpb ?

21 Quelques résultats Génome : 1,5% gènes (exons) > 50% répétitions (« junk DNA ») Gènes : ~3 kb (dystrophine = 2,4 Mb) Gènes : ~ 20000 – 25000 (~50% connus) Homme – Chimpanzé : similaire à 99% Homme – Homme : 0,08% de différence.

Télécharger ppt "Projet Génome Humain (HGP). Plan 1 ère heure Génome Tailles des génomes Projet « Génome Humain » Technique Séquençage 2 ème heure Enjeux (discussion)"

Présentations similaires

Annonces Google