La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Nadia El-Mabrouk Structures secondaires dARN: prédiction et recherche.

Présentations similaires


Présentation au sujet: "Nadia El-Mabrouk Structures secondaires dARN: prédiction et recherche."— Transcription de la présentation:

1 Nadia El-Mabrouk Structures secondaires dARN: prédiction et recherche

2 Plan I. Introduction II. Représentation formelle dune structure secondaire dARN III. Éléments structuraux IV. Prédiction de la structure secondaire dun ARN 1. Co-variance 2. Considérations thermodynamiques 3. Algorithme de Pipas & McMahon 4. Algorithme de Nussinov 5. Algorithme de Zuker V. Recherche de structures secondaires

3 I. Introduction - ARN Les ARN étaient vus exclusivement comme lintermédiaire entre lADN et les protéines. Rôle exclusif dans la transcription/traduction du message contenu dans lADN. Depuis 1980: découverte dARN non codants (non transcrits en protéines), jouant de multiples rôles dans la cellule: fonction catalytique, régulation de la transcription, épissage des introns, expression des gènes… De nouveaux ARN sont découverts continuellement. Conception dARN artificiels, en particulier miARN, permettant de contrôler lexpression de certains gènes impliqués dans des maladies comme le cancer.

4 I. Introduction - ARN non-codant Un ARN non-codant (ncRNA) est un ARN fonctionnel qui nest pas traduit en protéine: tous les ARN autres que les ARNm. Gène dARN: Séquence dADN transcrite en un ARN non- codant. ARN non-codants inclu: Les familles dARN ayant un rôle fondamentale dans la synthèse des protéines: ARN de transfert (ARNt ou tRNA) ARN ribosomique (ARNr) Beaucoup dautres familles découvertes plus récemment, dont les fonctions ne sont pas toujours connues: snoRNAs, microRNAs, siRNAs, piRNAs, RNase P…snoRNAsmicroRNAs siRNAs

5 I. Introduction - Séquence dARN Structure primaire: Séquence linéaire de 4 acides ribonucléiques: A(dénine), C(ytosine), G(uanine), U(racile) Un gène dARN est transcrit en une séquence primaire dARN:

6 I. Introduction - Séquence dARN Major & Thibault (2007) In From Genomes to Therapies Wiley-VCH. pp The riboses and the phosphate groups constitute the backbone and are linked through diester bonds: C5 O5 and C3 O3. The chain C3 O3 P O5 C5 from one ribose to another is therefore referred to as the phosphodiester linkage

7 I. Introduction - Structure secondaire En se repliant, la molécule dARN forme une structure stabilisée par la force des ponts hydrogènes entre certaines paires de bases (A-U, C-G, G-U) et lempilement de paires de bases voisines. Cest la structure secondaire de la molécule. Paires de bases Watson-Crick: G-C et A-U Paire de bases Wobble: G-U La paire G-C est celle qui donne le plus de stabilité, puis A-U, puis G-U. sciences.com/_actualites/base-adn.html

8 I. Introduction Dautres appariements sont possibles Saenger (1984) Principles of Nucleic Acid Structure, Springer-Verlag, p

9 I. Introduction Exemple: lARN de transfert LARN de transfert est l« interpréteur » des codons de lARNm. Le rôle de lARN de transfert est de transférer les acides aminés du cytoplasme au ribosome. Il existe un ARNt spécifique pour chaque AA. Chaque ARN de transfert a un triplet spécifique appelé « anticodon », qui sapparie au codon complémentaire sur lARNm. Des enzymes appelées ARN Synthétases, chargent chaque ARNt avec son AA propre.

10 I. Introduction Exemple: lARN de transfert

11 I. Introduction Exemple: lARN de transfert Molécule denviron nucléotides. Structure secondaire de lARNt En « feuille de trèfle » LAA correspondant à lanticodon sattache au bras accepteur.

12 I. Introduction Exemple: lARN de transfert Some nucleotides in tRNA have been modified, such as dihydrouridine (D),pseudouridine (Y), and inosine (I). In dihydrouridine, a hydrogen atom is added to each C5 and C6 of uracil. In pseudouridine, the ribose is attached to C5, instead of the normal N1. Inosine plays an important role in codon recognition. In addition to these modifications, a few nucleosides are methylated.Inosine

13 I. Introduction Structure tertiaire La structure secondaire peut être vue comme une structure « intermédiaire » entre la structure primaire et la structure tertiaire (3D)

14 II. Représentation formelle Définition « théorique » dune structure sec. dARN Pairages permis: Watson-Crick (G-C, A-U) et Wobble (G-U); Chaque base ne peut être appariée quà une seule autre base; Pas de « sharp turn »: au moins 3 bases par boucle; Pas de pseudo-noeuds

15 II. Représentation formelle dune structure secondaire dARN

16 ACGGAGUGCUAAUGGACGUAUUGCCUCAGCUACUGCAAGGUAUACUGU Expression bien parenthésée: ( ( ( ( ( ( ( ) ) ) ) ( ( ( ( ( ) ) ) ) ) ) ) )

17 III. Éléments structuraux Tige-boucle ou hélice Boucle interne Empilements Renflement Boucle multiple

18 III. Élements structuraux Intéractions Inter-éléments (Pseudo-nœuds) D.

19 III. Éléments structuraux Boucle interne Empilement Boucle multiple Tige-Boucle 1-boucle: Boucle 2-boucle: Empilement Boucle interne Bulge n-boucle: Boucle multiple, i.e. fermée par n appariements. boucle

20 IV. Prédiction de structures secondaires. 1. Co-variance Une séquence peut se replier dune multitude de façons. Alignement multiple de séquences homologues: permet de retrouver les sites de co-variance (Woese & Pace, 1993)

21 IV. Prédiction 2. Considérations thermodynamiques Les ARN ne se replient pas dans des structures aléatoires En général, ils préfèrent les conformations de basses énergies En mécanique statistique, les conformations de basses énergies correspondent à celles qui sont souvent observées. Le calcul exact de lénergie E pour une structure arbitraire S est impossible. En pratique: Évaluation expérimentale de lénergie libre associée à de petits ARN synthétiques (boucles élémentaires); Utiliser lhypothèse de Tinoco-Uhlenbeck pour évaluer lénergie libre dune structure complexe S formée par une suite de boucles.

22 IV. Prédiction 2. Considérations thermodynamiques Hypothèse de Tinoco-Uhlenbeck Soit S une structure, et s 1, s 2, … s n la suite des boucles formant S. Alors: E(S) = e(s 1 )+e(s 2 )+…+e(s n ) e(s i ), pour 1 i n, estimées expérimentalement. Dépend du type de boucle.

23 2. Caractéristiques générales de lénergie libre e(s) est négatif si et seulement si s est un empilement: seules boucles qui contribuent à la stabilité de la molécule. Un empilement (G-C)(G-C) plus stable quun empilement (A-U)(A-U). Les zones externes non appariées ne font partie daucun cycle score nul. Si E(S)>0, alors S ne peut pas être stable.

24 A/UC/GG/CU/AG/UU/G A/U C/G G/C U/A G/U U/G Turner, Sugimoto (1988) Énergie dempilement de paires de base (kcal/mole à 37degC) : Énergie de destabilisation pour les autres boucles: Nombre de bases Boucle interne Bulge Épingle à cheveux Serra, Turner (1995)

25 IV. Prédiction de structures secondaires par minimisation de lénergie libre Algorithmes combinatoires: Pipas & McMahon 1975 Algorithmes récursifs (Prog. dynamique ): Nussinov 1978 Zuker & Steigler 1981, Zuker & Sankoff 1984, Sankoff 1985 … O(n 3 ) en espace, O(n 2 ) en temps. Logiciels: ViennaRNA software: Schuster et al. 1994, MFOLD software: Zuker et al. 1989

26 IV. Prédiction 3. Algorithme de Pipas & McMahon Faire la liste de toutes les tige-boucles possibles Dans lalgorithme, n est la taille de la séquence, et p la taille minimale dune boucle Pour i = 1 à n-(p+1) Faire Pour j = i+p+1 à n Faire Si ( pair( i, j ) ) Faire // Former lhélice ( i, j ) l = 1 Tant que ( pair( i-l, j+l ) ) Faire l++ // Si ( l > lmin ) conserver lhélice( i, j, l ) dans un ensemble FinPour

27 IV. Prédiction 3. Algorithme de Pipas & McMahon Faire la liste de toutes les tige-boucles possibles Créer toutes les structures secondaires possibles en formant tous les sous-ensemble de tiges-boucles (hélices) compatibles possibles. Compléter chaque structure et évaluer son énergie libre. Problème: Il y a 2 n structures secondaires possibles!!

28 IV Prédiction Algorithme de Nussinov (1978) Premier algorithme de programmation dynamique pour calculer le repliement dune séquence dARN qui maximise le nombre de paires de bases créées. Problématique: Étant donnée une séquence S[1,n], trouver le repliement de S qui maximise le nombre de paires de bases. Idée: Il y a 4 façons de calculer la meilleure structure du facteur S[i,j], pour 1i j n, à partir de facteurs de S[i,j]: Notes de cours dAlessandra Carbone

29 (i,j) forment un appariement quon ajoute à la meilleure structure pour la séquence S[i+1, j-1] i est non-apparié et on lajoute à la meilleure structure pour la séquence S[i+1, j] j est non-apparié et on lajoute à la meilleure structure pour la séquence S[i, j-1] Combiner deux structures optimales, lune pour la séquence S[i,k], et lautre pour la séquence S[k+1,j], pour i+1k j-1 Notes de cours dAlessandra Carbone IV Prédiction Algorithme de Nussinov (1978)

30 D(i,j): nombre max. de paires de bases qui peuvent être formées pour la sous-séquence S[i,j]. Remplire une Table de programmation dynamique D de n lignes et n colonnes: Cas de base: D(i,i) =0, pour 1i n D(i,i-1) = 0 pour 2i n IV Prédiction Algorithme de Nussinov (1978)

31 GGGAAAUCC G0 G00 G00 A00 A00 A00 U00 C00 C00 i j

32 D(i,j): nombre max. de paires de bases qui peuvent être formées pour la sous-séquence S[i,j]. Remplire une Table de programmation dynamique D de n lignes et n colonnes: Cas de base: D(i,i) =0, pour 1i n D(i,i-1) = 0 pour 2i n Remplire D diagonale par diagonale, pour 0

33 GGGAAAUCC G0 G00 G00 A00 A00 A00 U00 C00 C00 1 i= j=89

34 GGGAAAUCC G0 G00 G00 A00 A00 A00 U00 C00 C00 i j

35 GGGAAAUCC G0 G00 G00 A00 A00 A00 U00 C00 C G G -C A -U AA

36 IV Prédiction Algorithme de Zuker ( ) Une différence importante avec lalgorithme de Nussinov est que lénergie dune paire de bases est calculée en fonction de la paire de bases précédente (stacking)

37 IV Prédiction Algorithme de Zuker ( )

38 Algorithme de Zuker

39 GGGAAAUCC G0 G00 G00 A00 A00 A00 U00 C00 C00 1 i= j=89

40 Complexité: Épingles à cheveux et empilements: Temps constant pour chaque (i,j) O(n 2 ) Bulge: O(n) pour chaque (i,j) O(n 3 ) Boucles internes: O(n 2 ) pour chaque (i,j) O(n 4 ) IV Prédiction Algorithme de Zuker ( )

41 V. Recherche de structures secondaires Entrée: Une caractérisation de la structure secondaire dune famille dARN But: Identifier tous ces ARN dans un génome

42 V. Recherche Expression régulière EXPRESSION RÉGULIÈRE définie sur un alphabet par: Ø, e, et tout a de sont des expressions régulières et si S et R sont deux expressions régulières alors: RS est une expression régulière (concaténation) R | S est une exp. Reg. (ou) R * est une ex. reg (étoile de Kleene) Exemple: hélice G (C|U)(A|C|G|U)N*(A|C|G|U)(A|G)C G Y N C R N N*

43 V. Recherche Automate fini Une expression régulière est reconnue par un automate fini. Exemple: ((AC)|G)(A|C)T(T|G)((GT)|C)

44 V. Recherche Alignement dune expression régulière avec une séquence Revient à lalignement dautomates (Myers and Miller 1989) Exemple: E = (A|C) T (T|G) S = A T A T

45 V. Recherche Structure secondaire Peut-être reconnue par un automate à piles Exemple: R Y Y R N* A G C T N G A T C ère partie de lhélice 2ème partie de lhélice boucle

46 A G C T N G A T C ère partie de lhélice 2ème partie de lhélice boucle P = A T G G G A C 1 4 La pile nest pas vide Le mot nest pas reconnu par lautomate à piles.


Télécharger ppt "Nadia El-Mabrouk Structures secondaires dARN: prédiction et recherche."

Présentations similaires


Annonces Google