La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Octobre 2007Génétique bactérienne1 G É N É TIQUE BACT É RIENNE.

Présentations similaires


Présentation au sujet: "Octobre 2007Génétique bactérienne1 G É N É TIQUE BACT É RIENNE."— Transcription de la présentation:

1 octobre 2007Génétique bactérienne1 G É N É TIQUE BACT É RIENNE

2 octobre 2007Génétique bactérienne2 Stabilité des caractères phénotypiques bactériens ? Antibiothérapie et résistances… Transmission des variations ou changements… Génétique =

3 octobre 2007Génétique bactérienne3 1. Les mutations

4 octobre 2007Génétique bactérienne4 1.1. Mise en évidence

5 octobre 2007Génétique bactérienne5

6 octobre 2007Génétique bactérienne6 1.2. Bases biochimiques des mutations erreur de lenzyme de polymérisation (DNA polymérase DNA dépendante) erreur des systèmes de réparation des erreurs

7 octobre 2007Génétique bactérienne7 1.2. Bases biochimiques des mutations action de mutagènes

8 octobre 2007Génétique bactérienne8 1.2. Bases biochimiques des mutations modification dune base 1 AUGUACGCGAUCGAUCGCGCUACUCCGAUCGGCAUCGACU 40 M Y A I D R A T P I G I D 1 AUGUUACGCGAUCGAUCGCGCUACUCCGAUCGGCAUCGACU 41 M L R D R S R Y S D R H R 1 AUGACGCGAUCGAUCGCGCUACUCCGAUCGGCAUCGACU 39 M T R S I A L L R S A S T insertion ou délétion de bases 1 AUGUAUGCGAUCGAUCGCGCUACUCCGAUCGGCAUCGACU 40 M Y A I D R A T P I G I D

9 octobre 2007Génétique bactérienne9 1.3. Diff é rents types de mutants mutants morphologiques mutants nutritionnels

10 octobre 2007Génétique bactérienne10 1.4. Caractères des mutations.1 a. Expérience de Lederberg : Quel rapport entre la mutation et leffet de la mutation ? Ou La streptomycine provoque-t-elle la mutation rendant les bactéries résistantes ?

11 octobre 2007Génétique bactérienne11 b. Fréquence des mutations c. mutations particulières - mutants réverses, - mutants thermosensibles.

12 octobre 2007Génétique bactérienne12 1.5. Application : test de Ames Test de Ames : test de leffet mutagène dune molécule X en déterminant le taux de mutants réverses de Salmonella his - sous laction de X + X + à forte dose

13 octobre 2007Génétique bactérienne13 2. Les transferts g é n é tiques

14 octobre 2007Génétique bactérienne14 2.1. TRANSFORMATION

15 octobre 2007Génétique bactérienne15 2.1. TRANSFORMATION

16 octobre 2007Génétique bactérienne16 2.1. TRANSFORMATION

17 octobre 2007Génétique bactérienne17 2.1. TRANSFORMATION

18 octobre 2007Génétique bactérienne18 2.2. CONJUGAISON

19 octobre 2007Génétique bactérienne19 2.2. CONJUGAISON

20 octobre 2007Génétique bactérienne20 2.2. CONJUGAISON

21 octobre 2007Génétique bactérienne21 2.2. CONJUGAISON

22 octobre 2007Génétique bactérienne22 2.2. CONJUGAISON

23 octobre 2007Génétique bactérienne23 2.2. CONJUGAISON

24 octobre 2007Génétique bactérienne24 2.2. CONJUGAISON

25 octobre 2007Génétique bactérienne25 2.3. TRANSDUCTION

26 octobre 2007Génétique bactérienne26 2.3. TRANSDUCTION

27 octobre 2007Génétique bactérienne27 2.3. TRANSDUCTION

28 octobre 2007Génétique bactérienne28 2.3. TRANSDUCTION

29 octobre 2007Génétique bactérienne29 2.3. TRANSDUCTION

30 octobre 2007Génétique bactérienne30 2.4. TRANSPOSONS Transposons = séquences de DNA mobiles intégrées dans le DNA chromosomique et/ou plasmidique (=réplicon) napparaissant jamais libres, et dont la réplication est liée à celle du DNA « hôte ».

31 octobre 2007Génétique bactérienne31 2.4. TRANSPOSONS

32 octobre 2007Génétique bactérienne32 2.4. TRANSPOSONS

33 octobre 2007Génétique bactérienne33 2.5. INTÉGRONS Intégron = système de capture et dexpression de gènes sous forme de cassettes. Les cassettes sont des gènes qui peuvent être int é gr é s dans l int é gron ou excis é s par l int é grase cod é e par le g è ne intI de l int é gron

34 octobre 2007Génétique bactérienne34 3. R é gulations …

35 octobre 2007Génétique bactérienne35 3.1. Travaux de monod-lwoff-jacob

36 octobre 2007Génétique bactérienne36 3.1. Travaux de monod-lwoff-jacob

37 octobre 2007Génétique bactérienne37 3.1. Travaux de Monod-Lwoff-Jacob la quantité de -galactosidase varie en fonction des conditions de culture : très faible en absence de lactose (1 à 5 molécules par bactérie) forte en présence de lactose mais ainsi danalogue de lactose de type méthyl-galactose sous forme pyrranique et cela bien que lenzyme ne puisse les couper (10 000 molécules par bactérie) Ils en déduisent que la synthèse de la -galactosidase est donc INDUITE par des molécules possédant une structure -galactopyranoside. Ces molécules sont des INDUCTEURS il existe des mutants incapables de produire lenzyme il existe des mutants synthétisant de grandes quantités de lenzyme quel que soient les conditions de milieu. (mutants constitutifs) Ils en déduisent que cest au niveau du DNA bactérien quil existe un système inductible qui empêche la synthèse de lenzyme, système qui peut être détruit. la synthèse de la -galactosidase est toujours accompagnée de celle de la perméase et dune transacétylase

38 octobre 2007Génétique bactérienne38 3.2. Le modèle de lOpéron Les trois protéines sont liées sous la forme de trois gènes successifs. Un même mRNA sert à la synthèse. Gène de la - galactosidase Gène de la - galactoside perméase Gène de la transacétylase

39 octobre 2007Génétique bactérienne39 3.2. Le modèle de lOpéron Le répresseur est une protéine capable de se fixer sur le DNA. Cette protéine est allostérique : elle change de conformation en présence dun ligand. Répresseur (protéine) En présence de linducteur En absence de linducteur inducteur

40 octobre 2007Génétique bactérienne40 3.2. Le modèle de lOpéron Les trois protéines sont liées sous la forme de trois gènes successifs. Un même mRNA sert à la synthèse. Gène de la - galactosidase Gène de la - galactoside perméase Gène de la transacétylase Répresseur (protéine) En présence de linducteur En absence de linducteur inducteur Opérateur Promoteur Gène du répresseur

41 octobre 2007Génétique bactérienne41 3.2. Le modèle de lOpéron Gène de la - galactosidase Gène de la - galactoside perméase Gène de la transacétylase Répresseur (protéine) En présence de linducteur En absence de linducteur inducteur Opérateur Site de fixation du répresseur Promoteur site de fixation de la RNA polymérase DNA dépendante Gène du répresseur RNA polymérase DNA dépendante

42 octobre 2007Génétique bactérienne42 3.2. Le modèle de lOpéron ABSENCE DINDUCTEUR PRÉSENCE DINDUCTEUR

43 octobre 2007Génétique bactérienne43 3.3. Les phases chez Salmonella

44 octobre 2007Génétique bactérienne44 3.3. Les phases chez Salmonella

45 octobre 2007Génétique bactérienne45 3.3. Les phases chez Salmonella Expression H1 Expression H2

46 octobre 2007Génétique bactérienne46


Télécharger ppt "Octobre 2007Génétique bactérienne1 G É N É TIQUE BACT É RIENNE."

Présentations similaires


Annonces Google