La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Identification des individus par lADN Les Empreintes Génétiques ?

Présentations similaires


Présentation au sujet: "Identification des individus par lADN Les Empreintes Génétiques ?"— Transcription de la présentation:

1

2 Identification des individus par lADN Les Empreintes Génétiques ?

3 îQuelques dates îQuelques dates... îLes deux ADN: Caractéristiques et techniques d analyse îApplications : de lADN nucléaire de lADN mitochondrial

4 í1985 : Sir A. JEFFREYS í1989 : Premières expertises en France í1994 : ADN mitochondrial í1994 : Loi sur la bioéthique í1997 : Habilitation des experts í1998 : Création du fichier national Quelques dates : L ADN, support de l information génétique 1970 : Essor technologique ….

5 Les Empreintes Génétiques îQuelques dates... îLes deux ADN: Caractéristiques et techniques d analyse

6 ADN Acide Désoxyribonucléique La Molécule dADN Cellule Mitochondries Noyau Chromosome

7 Les deux ADN : Caractéristiques Cellule Mitochondries Noyau ADN nucléaire ADN mitochondrial

8 Les deux ADN : Différences Noyau Mitochondries Chromosomes (23 paires) + XY ADN nucléaire ADN mitochondrial

9 + ADN nucléaire + Les deux ADN : Différences

10 ADN nucléaire Variations de taille Noyau Chromosomes Variation dun individu à lautre du nombre de motifs répétés 1 Locus STR 2 Allèles

11 ADN mitochondrial Variations de séquence Mitochondrie ADN CAGTACATAGCAGTACATAG Variations de séquence dun individu à lautre (sauf apparentés par la lignée maternelle)

12 ADN nucléaire ADN mitochondrial 2 copies (2 chromosomes) Transmission biparentale Variation de taille Absent dans tige des cheveux Milliers de copies Transmission maternelle Variation de séquence Présent dans tige des cheveux Chaque individu est unique (sauf les vrais jumeaux) Tous les individus dune même lignée maternelle sont identiques Les deux ADN : Différences

13 4 De 1985 à 1995 : - VNTR et Southern-Blot Techniques danalyse de lADN nucléaire 4 Depuis 1995 STR et PCR - STR et PCR

14 Technique de PCR = Amplification Techniques danalyse de lADN nucléaire

15 Electrophorèse - +

16 - + LASER Visualisation Techniques danalyse de lADN nucléaire

17 Comparaison Référence = Marqueur allélique ADN inconnu Assignation des Allèles Comparaison Caractérisation de l ADN inconnu Techniques danalyse de lADN nucléaire = Génotype

18 PCR Electrophorèse PCR multiplex : 11 à 16 locus STR simultanés LASER Techniques danalyse de lADN nucléaire

19 Comparaison avec le marqueur allélique

20 Empreinte génétique masculine obtenue par lanalyse de dix motifs répétés (STR) différents Techniques danalyse de lADN nucléaire Assignation des allèles inconnus

21 Comparaison d empreintes génétiques Marqueur Référence n° Inconnu Référence n°2 Techniques danalyse de lADN nucléaire Exclusion Identité

22 Technique danalyse de lADN mitochondrial HV1HV2 Locus Variations de séquence

23 Séquences amplifiées spécifiques à la race humaine HV1HV2 Technique danalyse de lADN mitochondrial Comparaison à la Séquence de référence d «Anderson» PCR TTCTTT……..CGTCCC GGGGGT……..AAACAC Séquençage

24 Caractérisation de l ADN inconnu Mutations …CCACTCTTAGC... …CCACCCTTAAC... ADN inconnu Séquence Anderson Position Comparaison Technique danalyse de lADN mitochondrial Mitotype de lADN inconnu :16294 T G

25 ...AACCTGCCTA......AGCCTGCCCA... ADN inconnu ADN de référence n°1...AACCTGCCTA...ADN de référence n°2 Identité Exclusion Comparaison de mitotypes Technique danalyse de lADN mitochondrial

26 Comparaison de mitotypes Technique danalyse de lADN mitochondrial

27 Les Empreintes Génétiques îQuelques dates... îLes deux ADN: Caractéristiques et techniques d analyse îApplications : de lADN nucléaire de lADN mitochondrial

28 íTests de filiation (paternité …) íAgressions homo ou hétérosexuelles íHomicides íAutres délits (vols, violences, …) Applications de lADN nucléaire A chaque fois que lon dispose de substance biologique : sang, sperme, salive …

29 ? Applications de lADN nucléaire Tests de Filiation Etablir un lien de parenté

30 Tests de Filiation Les prélèvements 4 Sang 4 Salive 4Produit d IVG 4 Muscle

31 Interprétation Fausse paternité Interprétation : Fausse paternité Tests de Filiation

32 Mère Enfant Père Exemple de fausse paternité Tests de Filiation

33 Interprétation : Vraie paternité Tests de Filiation

34 Exemple de vraie paternité Mère Enfant Père Tests de Filiation

35 Applications de lADN nucléaire Agressions sexuelles = ? Identifier l auteur de l agression

36 íPréservatifs íPréservatifs (2 faces analysées indépendamment) Agressions sexuelles Autres prélèvements íObjets de literie íObjets introduits íTout objet abandonné sur les lieux par lagresseur

37 Prélèvement (mélange) Fraction M (enrichie en spermatozoïdes) Fraction F (enrichie en cellules épithéliales) Agressions sexuelles Extraction différentielle de l ADN

38 62 Suspect n°2 Suspect n°1 35Exclusion Victime 34Identité 62 Fraction M 34 Fraction F Comparaisons Agressions sexuelles

39 Marqueur Victime Fraction F Fraction M Suspect Comparaisons Agressions sexuelles

40 Analyse des STR Y Viol en réunion Fraction M STR Autosomaux Suspect n°1 STR Y Fraction M STR Y

41 Identifier toute trace biologique Applications de lADN nucléaire Homicides Laissée par la victime sur lagresseur Laissée par lagresseur sur la victime

42 Marqueur Victime Suspect Pistolet Applications de lADN nucléaire Homicides

43 Le sang est-il celui de la victime ? A qui appartient le pantalon ? Sang Zones de frottement Vêtements

44 íMégots íChewing-gums, noyaux de fruit íDenrées alimentaires (sandwichs, beignet...) íBouteilles, verres, cuillères íBrosse à dents, lime à ongles íVêtements íPeignes, brosse à cheveux íGants íCagoules... Applications de lADN nucléaire Autres délits Tout support potentiel de matériel biologique

45 Salive Applications de lADN nucléaire Autres délits íCagoule

46 Les Empreintes Génétiques îQuelques dates... îLes deux ADN: Caractéristiques et techniques d analyse îApplications : de lADN nucléaire de lADN mitochondrial

47 A C G T ADN Rappels sur lADN mitochondrial í Milliers de copies í Transmission maternelle í Variation de séquence í Présent dans tige des cheveux Cellule mitochondries noyau

48 Quand lanalyse de lADN nucléaire nest pas possible ou pas nécessaire Applications de lADN mitochondrial î Identification de cadavres î Agression î Vols à main armée î Terrorisme...

49 í Prélevés sur cagoule (Vol à main armée, terrorisme…) í Prélevés dans la main dune victime (homicide) í Prélevés sur scène de crime (dans voiture, logement…) Applications de lADN mitochondrial 4Eléments pileux Essai danalyse de l ADN nucléaire (Sexe / Typage) Mais si... Présence d un bulbe Grande quantité d ADN

50 íMéthodologie complexe íTechnique longue íCoût plus important íPouvoir discriminant plus faible Applications de lADN mitochondrial íCheveux sans bulbe íÉchantillons très dégradés (cadavres, excréments) íÉchantillons en quantité très faible (micro-traces, …) Inconvénients Avantages Seule technique pour :

51 Les Empreintes Génétiques Conclusion

52 (1989) 1600 Activité des empreintes génétiques 40 (2000)

53 Les Empreintes Génétiques Ce que lon ne peut pas dire (aujourdhui)... RaceAge Caractères physiques

54 Laboratoire Magistrat Enquêteur Médecin légiste Les Empreintes Génétiques


Télécharger ppt "Identification des individus par lADN Les Empreintes Génétiques ?"

Présentations similaires


Annonces Google