La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Analyse du Génome de la cyanobactérie marine Prochlorococcus SS120, un exemple de génome (presque) minimal A. Dufresne 1, M. Galperin 2, K. Makarova 2,

Présentations similaires


Présentation au sujet: "Analyse du Génome de la cyanobactérie marine Prochlorococcus SS120, un exemple de génome (presque) minimal A. Dufresne 1, M. Galperin 2, K. Makarova 2,"— Transcription de la présentation:

1 Analyse du Génome de la cyanobactérie marine Prochlorococcus SS120, un exemple de génome (presque) minimal A. Dufresne 1, M. Galperin 2, K. Makarova 2, N. Tandeau de Marsac 3, D. Scanlan 4, W. Hess 5, M. Salanoubat 6 et F. Partensky 1 1 Station Biologique de Roscoff; 2 NCBI; 3 Institut Pasteur; 4 University of Warwick; 5 Humboldt University of Berlin; 6 Genoscope

2 CP47 CP43 D2 D1 Intracytoplasmic Membrane Cytoplasm Lumen CP43 CP47 D2 D1 Photosystem II h Pcb Barber et al, 2000 Pourquoi Séquencer le Génome de Prochlorococcus ? Cyanobactérie marine atypique Taille minuscule ( m): picocyanobactérie Pigments spécifiques: divinyl-chlorophylle a et b Antenne photocollectrice: protéine Pcb

3 Pourquoi Séquencer le Génome de Prochlorococcus ? Cyanobactérie marine atypique Taille minuscule ( m): picocyanobactérie Pigments spécifiques: divinyl-chlorophylle a et b Antenne photocollectrice: protéine Pcb Photosystem II CP47 CP43 D2 D1 Intracytoplasmic Membrane Lumen CP43 CP47 D2 D1 Phycobilisome ( cyanobactéries classiques) Cytoplasm h

4 Organisme photosynthétique le plus abondant 0 m -> 150 / 200 m de profondeur cellules / ml 40 à 60 % de la biomasse chlorophyllienne des zones oligotrophes Pourquoi Séquencer le Génome de Prochlorococcus ?

5 Adaptation à des niches écologiques différentes différents écotypes Pourquoi Séquencer le Génome de Prochlorococcus ? Isolats adaptés aux basses intensités lumineuses Isolats adaptés aux hautes intensités lumineuses Différences entre isolats: Photophysiologie (croissance) Rapport Chlb2 / Chla2

6 Gène de l'ARNr 16S Urbach et al, 1998 High light- adapted Low light- adapted Diversité génétique correllée avec la diversité physiologique Pourquoi Séquencer le Génome de Prochlorococcus ?

7 Génomes séquencés de Pico- cyanobactéries Marines High light- adapted Low light- adapted

8 Données: Genome OnLine Database *Syn: Synechococcus Prochlorococcus, un Génome Minuscule...

9 Séquençage réalisé au Genoscope >Prochlorococcus_SS120_ _bp aaagctagatggcagaaaggtttttgaataatttccacagattccacaagacctactacta ctgtattaatttcatataattaaattagaattactagaagaagagaaaacttttattaaagcta tgaaaactttttgttccttttttggtatttcgtagttatgttgaaccgatgaaacttgtttgttctcaaa ttgagctcaatacagctcttcaactagttagtagagctgtagccactaggccttcgcatccag tattggcaaatgtattgcttactgctgatgcgggaactggaaaactaagcttaactggatttga tcttaatttaggaattcaaacatcgcttagtgcttctatcgaaagtagtggagcaattacagttc cctcaaaacttttcggagaaataatatcaaaattatctagtgaatcttctataactttatcaac agatgattctagtgaacaagttaatttaa Annotation du génome de Prochlorococcus SS120

10 Identification des gènes codant pour des protéines

11 Critica Genemarks Glimmer 2274 ORFs 1884 ORFs Intergenic regions tBLASTx BLASTx Added nr Genomes PSI -BLAST tBLASTn Removed no hit < 50 aa Identification des gènes codant pour des protéines

12 Identification des gènes codant pour des protéines Nombreuses petites protéines (380 < 100 aa) Très peu de low complexity proteins

13 rRNAs genes: Similarity: BLASTn against genome sequence Query: rRNA genes of marine cyanobacteria 1 cluster of rRNA genes ttRNA genes: tRNAscan-SE: 40 tRNA genes Can use all amino-acids Identification of RNA genes Search for sequence similarity Search for similarity of secondary structure

14 COGs: Clusters of Orthologous Groups: Classification phylogénétique des protéines codées dans des génomes entièrement séquencés PSI-BLAST vs. NBCI-nonredundant: recherche d'homologues absents des COGs RPS-BLAST vs. Conserved Domain Database: recherche de domaines protéiques Identification des peptides signaux, hélices transmembranaires, domaines coiled-coil Détermination de la fonction des gènes

15 Gènes orthologues : Garde la même fonction Relation 1 à 1 entre orthologues Spéciation Ancêtre commun COGs: Clusters of Orthologous Groups:

16 COG: Cluster of Orthologous Groups of proteins Spéciation Relation 1 à plusieurs entre orthologues Gènes paralogues : nouvelles fonctions Duplication Ancêtre commun

17 Spéciation Duplication COG: Cluster of Orthologous Groups of proteins Relation plusieurs à plusieurs entre orthologues Ancêtre commun

18 alr4866 PsbA1 Pro025 2 PsbA sll1867 PsbA3 Bidirectional best hit Bidirectional best hit Bidirectional best hit All-against-all comparison with BLAST Construction des COGs Triangle = simplest COG

19 ------yqvdrlbcefghsnujxitw Absent uniquement des génomes d'archébactéries Phylogenetic patterns

20 aompkz Seulement dans les génomes d'archébactéries Phylogenetic patterns

21 Synechocystis PCC ORFs Prochlorococcus SS ORFs Anabaena PCC ORFs T. elongatus BP ORFs Best hits Construction des YOGs: cYanobacterial COGs

22 S T A S T P T A PS A P

23 S T T T A P P S SA P A 2260 YOGs créés Construction des YOGs: cYanobacterial COGs

24 Nombre de YOGs ne contenant que 3 génomes: Anabaena sp. PCC 7120 : 12 Synechocystis sp. PCC 6803 : 24 T. elongatus BP-1 : 67 Prochlorococcus SS120 : YOGs déjà présents dans les COGs YOGs spécifiques de cyanobactéries: 136 Principalement des gènes photosynthétiques Construction des YOGs: cYanobacterial COGs

25 Résultats de l'annotation

26 Voies de signalisation et de régulation Pas de photorécepteurs: phytochrome, cryptochrome, rodhopsine

27 Résultats de l'annotation Éléments génétiques mobiles Pas d'éléments transposables: séquences d'insertion et transposons Pas d'introns du groupe II Un retron ? Pas d'inteins Pas de réarrangements génomiques liés aux éléments transposables Genome plus stable ?

28 Résultats de l'annotation Gènes photosynthétiques Tous les gènes du PSI, PSII, Cyt b6/f sont en simple copie Pas de psbV ni de psbU

29 Comparaisons avec les cyanobactéries séquencées (eau douce) (Quasi) Disparition de catégories fonctionelles Peu de gènes paralogues, disparition de gènes bifonctionnels Petite taille du génome reliée au volume cellulaire (0,1 m 3 ) 2 avantages: Augmentation du rapport surface / volume Diminution du package effect (auto-ombrage) Résultats de l'annotation Conclusions Etat dérivé ou ancestral ?

30 16S-23S rDNA Spacer, 233 nt, ML Rocap et al, 2002, AEM Evolution des picocyanobactéries marines

31

32 Gènes codant pour les phycobilisomes Hess et al, 2002, Photosynthesis Research

33 Evolution des picocyanobactéries marines Gènes du métabolisme de l'azote

34 Evolution des picocyanobactéries marines

35 Comparaison des 4 génomes de picocyanobactéries marines Identifier des gènes spécifiques: d'un écotype => haute lumière (MED4, WH8102) / basse lumière (SS120, MIT9313) d'un genre => Prochlorococcus / Synechococcus d'une souche => MED4/SS120/MIT9313/WH8102 Définir de nouvelles cibles pour les études de génomique fonctionnelle (puces à ADN, protéomique) et de biologie moléculaire (mutants, PCR quantitative) Comprendre les bases moléculaires de l'adaptation au milieu marin et du succès écologique de Prochlorococcus et Synechococcus

36 Comparaison des 4 génomes de picocyanobactéries marines Nombre d'ORFs par catégorie

37 Comparaison des 4 génomes de picocyanobactéries marines Souches adaptées aux hautes intensités lumineuses

38 Conclusions Evolution vers un génome réduit et une petite taille cellulaire chez Prochlorococcus Exemple d'évolution réductive dans un organisme à vie libre Effets du milieu visibles sur les caractéristiques des génomes Peu de gènes spécifiques d'un écotype/genre/souche Majorité des gènes spécifiques sont sans fonctions connues et constituent des cibles pour expliquer l'adaptation de ces procaryotes à leurs niches écologiques.

39 Remerciements Eugene Koonin Michael Galperin Kira Makarova Yuri Wolf Igor Rogozin MARGENES Project ( ) Marcel Salanoubat Equipe Phytoplancton océanique Et Olivier Collin La Région Bretagne


Télécharger ppt "Analyse du Génome de la cyanobactérie marine Prochlorococcus SS120, un exemple de génome (presque) minimal A. Dufresne 1, M. Galperin 2, K. Makarova 2,"

Présentations similaires


Annonces Google