La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

11 mai 2006, Strasbourg L1 S2, ULP Licence L1S2 toute mention sauf Sciences du Vivant UE de découverte Les défis de la biologie Jeudi 11 mai 2006 14 à

Présentations similaires


Présentation au sujet: "11 mai 2006, Strasbourg L1 S2, ULP Licence L1S2 toute mention sauf Sciences du Vivant UE de découverte Les défis de la biologie Jeudi 11 mai 2006 14 à"— Transcription de la présentation:

1 11 mai 2006, Strasbourg L1 S2, ULP Licence L1S2 toute mention sauf Sciences du Vivant UE de découverte Les défis de la biologie Jeudi 11 mai à 16h (Amphithéâtre 4 Le Bel)

2 11 mai 2006, Strasbourg L1 S2, ULP Sil y a défi(s) comment le(s) relever ?

3 11 mai 2006, Strasbourg L1 S2, ULP Licence L1S2 toute mention sauf Sciences du Vivant UE de découverte Les défis de la biologie Pourquoi sintéresser à lhistoire évolutive des organismes vivants ? Jeudi 4 mai à 16h (Amphithéâtre 4 Le Bel)

4 11 mai 2006, Strasbourg L1 S2, ULP Saccharomyces cerevisiae Caenorabditis elegans Drosophila melanogaster Mus musculus Arabidopsis thaliana Organismes modèles

5 11 mai 2006, Strasbourg L1 S2, ULP Lévolution fait partie intégrante de la recherche fondamentale et de lenseignement supérieur Toute nouvelle découverte doit être restituée dans le contexte évolutif Mais

6 11 mai 2006, Strasbourg L1 S2, ULP Une constante dans lhistoire de lhumanité: lorigine et lévolution des organismes vivants ont toujours suscité un grand intérêt

7 11 mai 2006, Strasbourg L1 S2, ULP Détermination des liens de parenté entre : - organismes Histoire évolutive Le support beaucoup plus tard: - gènes Phylogénie

8 11 mai 2006, Strasbourg L1 S2, ULP Aristote déjà au quatrième siècle avant J. C. posait ces premières questions: chaque être engendre un autre être semblable à lui... lêtre est engendré par un être identique à lui-même il dénombrait déjà plusieurs milliers despèces il introduisait le mot espèce et par la même les relations entre espèces, ce qui à terme (20 siècles) débouchera sur le concept dévolution (Lamarck,...puis Darwin)

9 11 mai 2006, Strasbourg L1 S2, ULP Seule une infime partie des espèces est connue - le concept despèce nest pas unifié, donc le dénombrement est imprécis - linventaire est partiel et inégal et surtout impossible - un nombre immense et inconnu despèces sont éteintes quelques chiffres qui évoluent au cours du temps!...et ce nest pas fini

10 11 mai 2006, Strasbourg L1 S2, ULP Linné en 1758 connaissait 4163 espèces animales et un peu plus de plantes Il y aurait(!) actuellement plus de espèces vivantes répertorièes. Mais... lirréalisme dune telle question, dune réponse de sens.... la synonymie : Carabus cancellatus est décrit pour la première fois en 1758, cette espèce a depuis reçu 211 synonymes ! actuellement: nématodes répertoriés pour 1 million despèces supposées - 1 million dinsectes pour 3 à 30 millions (un facteur 10 !) - 99% des microorganismes ne sont pas cultivables au laboratoire et ne sont pas distinguables sur des critères morphologiques

11 11 mai 2006, Strasbourg L1 S2, ULP Un peu dhistoire

12 11 mai 2006, Strasbourg L1 S2, ULP Il y a 3,8 milliards dannées des éléments minéraux sassemblent pour constituer: - les premières molécules organiques - les premières macromolécules - donner naissance au métabolisme

13 11 mai 2006, Strasbourg L1 S2, ULP LUCA catalyse ARN RNP ribosome +code g. métabolisme archeaeubactérie ADN db (petit) replication ADN lipides et cellules protéines

14 11 mai 2006, Strasbourg L1 S2, ULP Protéines ARN ADN dogme central de la biologie

15 11 mai 2006, Strasbourg L1 S2, ULP Fixer la/une nouveauté, la stabiliser dans le temps: il y a sélection de la replication de lADN, stabilité de linformation = transfert entre générations

16 11 mai 2006, Strasbourg L1 S2, ULP On parle de gène(s) avant de parler plus tard de génome: Watson Crick (désoxyribo)nucléotide A, T, C,G, on mesure les génomes en 1000 nucléotides = 1Kb 1000 Kb = 1 Mb 1000 Mb = 1 Gb

17 11 mai 2006, Strasbourg L1 S2, ULP Gène = objet génétique pour simplifier une fraction dune grande molécule dADN où lon peut positionner - un début - une fin qui porte une information. Cette dernière après p étapes de réactions biochimiques donnera une forme (phénotype)

18 11 mai 2006, Strasbourg L1 S2, ULP une protéine fait en moyenne 500 résidus (acide aminé) (de qq dizaines à rarement plus de 4500) dans un cas simple la séquence de nucléotides pour faire cette protéine sera de 1500 nucléotides ou 1,5 Kb (X3) et la séquence codante du gène sera de 1500 nucléotides (ce nest pas la définition dun gène! avec ses séquences régulatrices un géne sera toujours dans cecas simple plutôt voisin de 2 Kb)

19 11 mai 2006, Strasbourg L1 S2, ULP Doù dérive ce terme génome? le mot génome a été utilisé pour la première fois en 1920 (H. Winckler) lensemble des caractères héréditaires dun être biologique donné à cette époque cela signifiait le lot de chromosomes

20 11 mai 2006, Strasbourg L1 S2, ULP Les gènes (objets génétiques): - se créent: fusions, délétions, éléments transposables éléments répétés - vivent : expréssion génique - meurent/disparaissent : pseudogènes et reliques mais il faut dabord savoir les identifier - donc certains sont cachés...où ? comment les détecter ?

21 11 mai 2006, Strasbourg L1 S2, ULP établir des règles de recherche, mais ces objets sont très variables en organisation et en taille: ces règles didentification sont (et resteront sans doute longtemps) imparfaites basées en partie sur la similarité, donc le connu le nombre de gènes contenu dans lADN,le génome, dun organisme donné est toujours une question ouverte par exemple la levure de boulanger

22 11 mai 2006, Strasbourg L1 S2, ULP Créer des gènes, nouveaux gènes, nouveautés génétiques: - duplication (compter les gènes) = copier puis coller de lADN dans de lADN - gène entier ou fragment ou morceau dADN mais il faut aussi réduire - délétion (compter les gènes) = couper, déléter puis recoller lADN - fusion entre deux gènes, deux fragments ou un fragment de gène et un morceau dADN Inventaire

23 11 mai 2006, Strasbourg L1 S2, ULP Eléments transposables (objet génétique): séquence dADN capable de se déplacer de façon autonome et de se multiplier dans le génome Ils sinsèrent au hasard dans le génome (+sens dinsertion) et vont parfois détruire lorganisation de gènes: mutations

24 11 mai 2006, Strasbourg L1 S2, ULP les éléments transposables peuvent être très nombreux: par exemple chez lhomme: quantification à partir du génome séquencé éléments soit 42% du génome (110 familles, I) En général, ces chiffres varient dune espèce à lautre et dune population à lautre dans une espèce donnée (voire dun individu à lautre!)

25 11 mai 2006, Strasbourg L1 S2, ULP Impact sur les génomes des éléments transposables: - séquences répétées identiques = peuvent se remanier on dit recombiner - insertion dans un gène = mutation(s) selon p déclinaisons = évolution du génome

26 11 mai 2006, Strasbourg L1 S2, ULP Animaux Bactéries Végétaux jusquen 1960 Lorganisation du monde vivant Eubactéries Eucaryotes Archées depuis 1990

27 11 mai 2006, Strasbourg L1 S2, ULP Les génomes de procaryotes sont relativements petits (600 à kb) Les génomes deucaryotes sont de tailles extraordinairement variables

28 11 mai 2006, Strasbourg L1 S2, ULP Les génomes deucaryotes sont de tailles extraordinairement variables: - en taille haploïde: de qq Mb à qq centaines de Gb - des organismes prochesont des tailles de génomes très différentes - pas de relation entre taille du génome et complexité de lorganisme

29 11 mai 2006, Strasbourg L1 S2, ULP Musa domesticainsecte/mouche900 Mb Anopheles gambiaeinsecte/moustique280 Mb Drosophila melanogaster insecte/mouche125 Mb Amoeba dubiaamibe670 Gb Pinus resinosaconifère 68 Gb Gallus gallusoiseau 1,2 Gb

30 11 mai 2006, Strasbourg L1 S2, ULP Il existe une bonne corrélation entre taille du génome et taille des cellules et de leur noyau et on observe en général - grands génomes = grandes cellules = divisions lentes - petits génomes = petites cellules = divisions rapides

31 11 mai 2006, Strasbourg L1 S2, ULP Forces évolutives, contraires, agissant sur la taille des génomes deucaryotes Diminution délétions = pertes dADN + sélection pour réduire le coût de la X Augmentation duplications = gain dADN + sélection pour augmenter ladaptation à un biotope donné

32 11 mai 2006, Strasbourg L1 S2, ULP Phylogénie classer, relier

33 11 mai 2006, Strasbourg L1 S2, ULP PRIMATES Lorisiformes Lémuriformes Tarsiiformes Platyrrhiniens Cercopithécoïdes Hylobatoïdés Hominines Panines Gorillinés Pongidés Strepsirrhiniens Haplorriniens Simiiformes Catarrhiniens Hominoïdes Hominoïdés Hominidés Homininés

34 11 mai 2006, Strasbourg L1 S2, ULP Comparer

35 11 mai 2006, Strasbourg L1 S2, ULP Quels types doutils pour explorer les génomes? - séquencer lADN (moderne et ancien) depuis 1977 (ancien = archéologie et domestication) - la génétique, seule discipline de la biologie qui ne fait pas appel à la physico-chimie mais à la statistique: croiser X des parents différents (ressemblance dissemblance) compter la descendance (test statistique) en tirer une loi (comment ceci ségrège) Gregor Mendel 1864

36 11 mai 2006, Strasbourg L1 S2, ULP Bonobo Le Condottiere par Antonello de Messine % identité en ADN 24 23

37 11 mai 2006, Strasbourg L1 S2, ULP le chromosome 2 de lhomme résulte de la fusion de deux chromosomes du chimpanzé (23 paires/24 paires) dautres montrent des différences de tailles (5, 6, 9 et 12)

38 11 mai 2006, Strasbourg L1 S2, ULP le chien, un loup (Canis lupus) domestiqué il y a environ ans variabilité à partir dun génome - sélection par lhomme - quels sont les gènes qui permettent ces différences? - comment?

39 11 mai 2006, Strasbourg L1 S2, ULP Beauceron Berger Allemand Caniche moyen Coton de Tuléar Westie Yorkshire Cocker Anglais Whippet Bouviers Bernois Borders Collies Setter GordonShih TzuLhassa-ApsoLabrador Pointer Boxer D.Bordeaux Epagneul Breton °°°

40 11 mai 2006, Strasbourg L1 S2, ULP partir de la séquence

41 11 mai 2006, Strasbourg L1 S2, ULP CTAATAAAAAGAAATGGTATTCTGCCAAACACCAAAGTGCCAAATAAGCATTATTTTACATAGTACGAAATGGAAATTACGTCAATTAT CGACATTATGACATAAAATTGGATTTAACAAGATGTCTGAATCTGATATGCTTCTTTCATTAGGGTGGAAATAACAGCATTTGAGAGAA GCAATTGCCAAGCTTCTATGAAAATTTTCTAGAAGGCAAGAGTATTTCAGACTTTCCTAATATGAAAGGACAAATTGACACTAATGTC TGATTATGGCCAATTCCTGCGGTAAATTACACGGCGATTACGGCGACATGAGCTCACATTCATCACTCTATGGGACAAATGTTTCCAA ACTGGGCGCAACAAACACCTGATGTGACTCCTACCCTTTGGACAATGCAGATCCACGCTACGGCAAATTAGTCAAATGCACTAGAAC ATGGCGCAAGTACTTATTGTGACCTTTGGGGTACCGTTACCGTCAGTTTTCTTCAGCTAAGGCGCGCGCGCCAGATAACTAAAAAAA AATATAGTTGCTGCTTAAAAAACAATACACCCGTACTCTCTTGCCTGTAAAAACCTCGAAGGACCAAAGATACCCTCAAGGTTCTCAT CTGTGCGGTATTCTTCAAATTACAATGACATTTCCCAAAATTATCAGATGTGCTCAGGTATCTTCTCTCCAATGAGATGAGACAGATGA ACATATTTGACCTTGAAGGTCATGGAAAGTAGGTTGAGAGCAAATGTGTAGAACGAAATTAAGAAAAAAAGAAATTACGCACGGCA TTAGCTCGATGACTTAGTTATAAATAGAGGCCTGGTATCGGCTGTCATGATCTCATCTCTTCCCTATTTACAAAAAAACTGCAAGTATA GACAATAAAACAACAGCACAAATATCAAAAAAGGAATTATGAGCAACGTTACTACGCCGTGGTGGAAACAATGGGACCCTTCTGAA GTTACACTTGCCGATAAAACCCCTGATGATGTGTGGAAGACCTGTGTTTTGCAAGGTGTTTACTTTGGTGGAAACGAGTACAATGGT AACTTAGGTGCCAGAATATCTTCCGTCTTTGTTATTCTTTTCGTGAGTACTTTTTTCACCATGTTCCCATTAATCTCAACAAAAGTGAA AAGATTGAGAATTCCTCTATATGTTTACCTTTTCGCAAAGTATTTTGGTTCCGGTGTTATTGTTGCAACCGCATTTATCCACTTAATGGA CCCTGCTTATGGTGCGATTGGTGGTACCACTTGTGTAGGACAAACCGGTAACTGGGGTCTTTATTCATGGTGTCCTGCCATTATGCTAA CGAGTTTGACCTTCACTTTCCTTACTGATCTATTCAGTAGCGTCTGGGTTGAAAGAAAGTATGGTCTTTCCCATGACCATACCCACGAT GAAATTAAAGACACTGTTGTGAGAAACACTGCAGCTGTTTCAAGTGAGAATGACAATGAGAATGGTACTGCAAATGGATCTCATGAC ACCAAGAACGGAGTAGAGTATTATGAAGATTCAGACGCTACATCCATGGATGTTGTTCAATCATTTCAAGCACAATTTTATGCCTTTTT AATTTTAGAATTCGGTGTGATTTTCCACTCCGTTATGATCGGTCTAAACCTGGGAAGTGTTGGTGATGAGTTCTCCTCCCTATACCCTG TCTTAGTGTTCCATCAATCATTTGAAGGTTTAGGTATTGGTGCAAGATTGTCAGCCATTGAATTCCCTAGATCAAAGAGATGGTGGCCA TGGGCCCTATGTGTTGCGTATGGGTTAACCACACCAATCTGTGTGGCCATCGGTTTGGGTGTTCGTACCAGATACGTCAGCGGTTCTT ACACTGCGCTTGTTATCTCTGGTGTTTTGGATGCCATTTCTGCTGGTATCTTATTGTACACTGGTTTGGTTGAACTACTAGCAAGAGAC TTTATATTCAATCCTCAAAGAACAAAGGATCTAAGAGAATTGTCCTTCAACGTTATATGCACTCTTTTCGGTGCTGGTATCATGGCTTT GATCGGTAAGTGGGCTTAAACCAAAGCGAAATTCTGCATGTTCCATATAGATTCTATTTCATATTTTATAGTTATTTATTCTTTAGTAATA GCAAAAAAACAGTAATAATTTTTCTTTAACAGTCTCGGACAATAAATACGCTAAAGAAGATGAAAATGACAACTTTTACGCTGGTGT GCACAAGTGGTACCAGAATACGTGGCCACCAAAACAATGACGGATATAGGGAGAACCAAGTCTAGAAATTACAAATGTTCTTTTGAC GGTTGTGAGAAAGTCTACAACAGACCTAGTTTGCTTCAGCAACACCAAAATTCGCATACCAATCAAAAGCCGTATCATTGTGATGAG CCGGGATGTGGCAAAAAATTTATAAGACCGTGCCATCTACGAGTTCACAAATGGACTCATTCACAAATCAAGCCCAAAGCGTGCACA TTATGTCAAAAAAGATTTGTCACAAATCAGCAATTAAGAAGGCATTTAAATAGTCATGAAAGAAAAAGCAAGCTTGCATCAAGAATT GACCGTAAACACGAAGGAGTGAATGCGAATGTGAAAGCAGAACTCAATGGCAAGGAGGGAGGTTTTGACCCAAAATTACCTTCCG GCTCTCCAATGTGTGGTGAAGAATTCTCGCAAGGTCATTTGCCTGGATATGATGACATGCAAGTGCTACAATGCCCATACAAATCATG TCAAAAAGTTACCAGCTTCAATGACGATCTAATAAATCATATGTTGCAACATCATATAGCAAGTAAGCTTGTTGTACCATCTGGAGAT

42 11 mai 2006, Strasbourg L1 S2, ULP pour aboutir à une carte physique

43 11 mai 2006, Strasbourg L1 S2, ULP

44 11 mai 2006, Strasbourg L1 S2, ULP Dans génomique on retrouve : - gène - génétique

45 11 mai 2006, Strasbourg L1 S2, ULP Un peu dhistoire de la génétique - loi de Mendel 1864 (1903) - ADN est le matériel génétique structure de lADN code génétique lADN recombinant les introns séquençage de lADN 1977

46 11 mai 2006, Strasbourg L1 S2, ULP Des questions déjà posées - quest ce quun gène? - comment(méthode) détecter un gène ? mais aussi - comment identifier la fonction dun gène (stratégies) ?

47 11 mai 2006, Strasbourg L1 S2, ULP Déterminer les objets génétiques: suivre des régles identifier le début et la fin dun objet pour conclure, - gène codant pour une protéine - gène dARN,... - transposon,... - etc

48 11 mai 2006, Strasbourg L1 S2, ULP On parle alors de génomique

49 11 mai 2006, Strasbourg L1 S2, ULP La domestication du chien deux hypothèses: - une seule en Eurasie ou - deux indépendantes en Eurasie et en Amérique Lanalyse delADN de squelettes de chiens venant des sites archéologiques Alaska, Mexique, Pérou,Bolivie comparée à celles issues de 250 loups actuels (30 sites de part le monde) et de 140 chiens actuels (67 races) indique que les chiens d Amérique dérivent de 4 types (haplotypes) de chiens actuels. Quil ny a eu quune seule domestication en Eurasie, quil y a eu une divergence significative parmi les lignées de chiens dEurasie avant quils naccompagnent les humains dans leurs migrations pré-Colombienne vers lAmérique

50 11 mai 2006, Strasbourg L1 S2, ULP La malaria résulte de linfection de H. s. s. par un parasite le Plasmodium falciparum(Apicomplexés). Le génome de P. falciparum révèle la présence dADN chloroplastique (non photosynthetic chloroplaste like) et indique que cet organisme résulte en fait dune endosymbiose, très lointaine, avec une algue. Il se multiplie dans le sang de lhôte et na pas de rapport avec les végétaux. Aplication recherche de drogues spécifiques (action sur le chloroplastes par sur H. s. s.)

51 11 mai 2006, Strasbourg L1 S2, ULP On observe et on observera dans tous les génomes que : - la redondance génique est élevée - il existe des gènes de fonction inconnue

52 11 mai 2006, Strasbourg L1 S2, ULP Sil y a duplication, il y a évolution biologique (histoire)

53 11 mai 2006, Strasbourg L1 S2, ULP - les êtres vivants ont une histoire - cette histoire est transmise cette histoire est lue grâce à la génétique et aux génomes

54 11 mai 2006, Strasbourg L1 S2, ULP - grâce à la génomique on peut : étudier des organismes réfractaires à une analyse expérimentale taille, cycle de reproduction, milieu atypique, etc...

55 11 mai 2006, Strasbourg L1 S2, ULP étudier des organismes qui ne sont pas analysables/cultivables sous forme isolées (non clones, populations, ) métagénomique ADN dorganismes présents dans les boues des stations dépuration

56 11 mai 2006, Strasbourg L1 S2, ULP séquence danammox : anaerobic ammonium oxidation la bactérie anammox a: - un temps de division long deux semaines- - elle nest pas cultivable sous forme de culture pure mais dassociations complexes de microorganismes

57 11 mai 2006, Strasbourg L1 S2, ULP expérience: - un bioréacteur de laboratoire, - UN AN de culture, - le DNA total, mélange, est extrait, séquençé, x étapes types taxonomiques identifiés sous forme de génomes

58 11 mai 2006, Strasbourg L1 S2, ULP la biodiversité est très faiblement explorée et mesurée, mais la génomique va permettre,en partie, cette exploration et de façon peu coûteuse

59 11 mai 2006, Strasbourg L1 S2, ULP Eucaryotes (gène codant pour une protéine) - Saccharomyces cerevisiae Caenorhabditis elegans Drosophila melanogaster Schizosaccharomyces pombe Arabidopsis thaliana Homo sapiens sapiens Oryza sativa Ratus norvegicus Tetraodon negroviridi 22400

60 11 mai 2006, Strasbourg L1 S2, ULP Quel est limpact du début de la période génomique? Quavons nous appris ? - le nombre de gènes est limité - la redondance génique est élevée - dans chaque génome on observe des gènes de fonction inconnue

61 11 mai 2006, Strasbourg L1 S2, ULP Merci de votre intérêt pour lanalyse des génomes


Télécharger ppt "11 mai 2006, Strasbourg L1 S2, ULP Licence L1S2 toute mention sauf Sciences du Vivant UE de découverte Les défis de la biologie Jeudi 11 mai 2006 14 à"

Présentations similaires


Annonces Google