La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

T UTORAT UE1 : S ÉANCE N °4 Correction 5-6 Décembre 2012.

Présentations similaires


Présentation au sujet: "T UTORAT UE1 : S ÉANCE N °4 Correction 5-6 Décembre 2012."— Transcription de la présentation:

1 T UTORAT UE1 : S ÉANCE N °4 Correction 5-6 Décembre 2012

2 1) C ONCERNANT LA STRUCTURE ET LES PROPRIÉTÉS DES ARN, QUELLE EST LA PROPOSITION FAUSSE ? A. Les ARN sont des molécules monocaténaires constituées de ribonucléotides unis par des liaisons phosphodiester B. Les ARN non codants ont tendance à adopter une structure pseudohélicoïdale prédéterminée C. La présence de l'hydroxyle en 2' des riboses fragilise les liaisons phosphodiester D. Les ARN de transferts sont les plus abondants E. Autre réponse

3 A) Les ARN sont des molécules monocaténaires constituées de ribonucléotides unis par des liaisons phosphodiester VRAI B) Les ARN non codants ont tendance à adopter une structure pseudohélicoïdale prédéterminée VRAI: forme de "trèfle" pour les ARNt, les ARN messagers n'ont pas une structure hélicoïdale prédéterminée. C) La présence de l'hydroxyle en 2' des riboses fragilise les liaisons phosphodiester des ARN VRAI: rôle catalytique possible, intervient notamment dans la formation du lariat (réactions de transestérification de l'épissage) D) Les ARN de transferts sont les plus abondants FAUX: les ARN ribosomiques sont les plus représentés Réponse D

4 2) P ARMI CES PROPOSITIONS, LAQUELLE ( LESQUELLES ) EST ( SONT ) EXACTES ? A. Chaque initiation de la réplication engage la cellule vers une nouvelle division B. Pendant toute la durée d’un cycle de réplication la division cellulaire ne peut pas s’engager. C. L’unité de réplication de l’ADN bicaténaire est le réplicon D. Plusieurs réplicons ne peuvent pas être localisés sur un même ADN bicaténaire E. Autre réponse

5 A) Chaque initiation de la réplication engage la cellule vers une nouvelle division Vrai, la cellule ne reste pas sous forme répliquée B) Pendant toute la durée d’un cycle de réplication la division cellulaire ne peut pas s’engager. Vrai, car sinon il y aurait des pertes d’information génétique C) L’unité de réplication de l’ADN bicaténaire est le réplicon Vrai, il possède une origine et une terminaison D) Plusieurs réplicons ne peuvent pas être localisés sur un même ADN bicaténaire Faux, plusieurs réplicons vont être activés en même temps sur un même ADN bicaténaire Réponses ABC

6 3) P ARMI CES PROPOSITIONS, LAQUELLE ( LESQUELLES ) EST ( SONT ) EXACTES ? A. Le brin matriciel est lu de 5’ vers 3’ B. L’élongation du brin se fait de 3’ en 5’ C. L’ADN polymérase-ADN dépendante nécessite la présence d’une amorce d’ADN ou d’ARN ayant une extrémité 3’ OH libre. D. L’ADN polymérase va avoir une activité exonucléasique qui va avoir un rôle dans la réparation de l’ADN. E. La synthèse de l’amorce nécessite la présence d’une extrémité 3’OH libre

7 A) Le brin matriciel est lu de 5’ vers 3’ Faux, il est lu de 3’ vers 5’ B) L’élongation du brin se fait de 3’ en 5’ Faux, l’élongation se fait de 5’ vers 3’ (c’est pour cela qu’il faut une extrémité 3’ OH libre) C) L’ADN polymérase-ADN dépendante nécessite la présence d’une amorce d’ADN ou d’ARN ayant une extrémité 3’ OH libre. Vrai, cette amorce sera excisée par la suite par une exonucléase ou endonucléase

8 D) L’ADN polymérase va avoir une activité exonucléasique qui va avoir un rôle dans la réparation de l’ADN. Vrai, l’activité exonucléasique de 5’ vers 3’ s’effectue en avant de la synthèse et a un rôle dans la réparation. L’activité exonucléasique de 3’ vers 5’ (proofreading) corrige un mauvais appariement des bases. E) La synthèse de l’amorce nécessite la présence d’une extrémité 3’OH libre Faux, car c’est l’amorce qui va créer cette extrémité 3’ OH libre Réponses CD

9 4) P ARMI CES PROPOSITIONS, LAQUELLE ( LESQUELLES ) EST ( SONT ) INEXACTES ? A. Le rôle de la Topoisomérase est de relâcher les contraintes de torsion de l’ADN. B. La synthèse des fragments d’Okazaki s’effectue sur le brin précoce C. La synthèse de l’amorce (ARN ou ADN) sur le brin tardif va s’effectuer grâce à une Primase : L’ADN polymérase α D. La cellule aura un nombre de cycle cellulaires limités du fait de la présence de la télomérase E. L’ADN polymérase δ ne sert qu’à la synthèse des fragments d’Okazaki

10 A) Le rôle de la Topoisomérase est de relâcher les contraintes de torsion de l’ADN. Vrai, elle permet de maintenir l’ADN dans une structure qui permet sa réplication B) La synthèse des fragments d’Okazaki s’effectue sur le brin précoce Faux, sur le brin tardif. Le brin précoce est le siège d’une synthèse continue. C) La synthèse de l’amorce (ARN ou ADN) sur le brin tardif va s’effectuer grâce à une Primase : L’ADN polymérase α Vrai, c’est elle qui va permettre de présenter une extrémité 3’ OH libre

11 D) La cellule aura un nombre de cycle cellulaires limités du fait de la présence de la télomérase Faux, elle a effectivement un nombre de cycle cellulaires limités mais la télomérase va justement permettre l’ajout de séquences répétées d’ADN qui vont augmenter le nombre de divisions cellulaires possibles E) L’ADN polymérase δ ne sert qu’à la synthèse des fragments d’Okazaki Faux, elle sert aussi à la réparation dans la réparation par excision de nucléotide (NER) Réponses BDE

12 5) D ANS QUEL ORDRE INTERVIENNENT CES DIFFÉRENTES PROTÉINES ET ENZYMES IMPLIQUÉES DANS LA RÉPLICATION ? 1) Protéines SSB 2) ADN Polymérase 3) ADN ligase 4) Protéine de reconnaissance 5) Hélicase 6) Topoisomérase 7) Primase A) 5, 6, 4, 7, 1, 2, 3 B) 4, 6, 5, 1, 7, 2, 3 C) 1, 7, 5, 4, 6, 2, 3 D) 4, 7, 5, 6, 1, 2, 3 E) Autre réponse

13 1) Protéine de reconnaissance (4) 2) Hélicase (déroule la double hélice) (5) 3) Topoisomérase (relâche les contraintes) (6) 4) Protéines SSB (1) 5) Primase : synthétise l’amorce (7) 6) ADN polymérase (2) 7) ADN ligase (catalyse la formation de la liaison phosphodiester) (3) E :

14 6) P ARMI CES PROPOSITIONS, LAQUELLE ( LESQUELLES ) EST ( SONT ) EXACTES ? A. L’ADN peut être réparé contrairement à l’ARN B. La dépurination est plus fréquente que la dépyrimidation C. La réparation par réversion fait intervenir une photolyase, une ADN ligase ou une purine insertase. D. L’addition d’une molécule exogène va entrainer un blocage de la machinerie de réplication E. Les lésions endogènes sont exclusivement provoquées par des agents mutagènes

15 A) L’ADN peut être réparé contrairement à l’ARN Faux, il existe des mécanismes de réparation pour l’ADN mais aussi pour l’ARN (il existe deux mécanismes de corrections : pyrophosphorolytique et hydrolytique) mais les mécanismes de réparation sont beaucoup plus développés et efficaces pour l’ADN B) La dépurination est plus fréquente que la dépyrimidation Vrai, la dépurination va entrainer la formation d’un site AP C) La réparation par réversion fait intervenir une photolyase, une ADN ligase ou une purine insertase. Vrai, ce sont des mécanismes qui coutent peu d’énergie.

16 D) L’addition d’une molécule exogène va entrainer un blocage de la machinerie de réplication Vrai, la molécule exogène va bloquer la mise en place du réplicon E) Les lésions endogènes sont exclusivement provoquées par des agents mutagènes Faux, les lésions endogènes sont provoquées sans agent exogène et vont entrainer des mésappariements de base ou des changements de séquence si la réparation est incorrecte Réponses BCD

17 7) C ONCERNANT LA RÉPARATION PAR EXCISION DE BASE (BER) QUELLES SONT LES PROPOSITIONS EXACTES ? A. Elle est impliquée majoritairement dans les réparations de mutations exogènes. B. Elle s’effectue en deux étapes C. L’ADN polymérase α intervient D. Elle nécessite une endonucléase E. Il y a création d’un site AP

18 A) Elle est impliquée majoritairement dans les réparations de mutations exogènes. Faux, dépurination, désamination, oxydation et alkylation, qui sont des mutations endogènes. B) Elle s’effectue en deux étapes Vrai, Il y a formation d’un site AP, puis il y a formation d’une brèche avec une endonucléase. C) L’ADN polymérase α intervient Faux, c’est l’ADN polymérase β, car il y a synthèse d’un seul nucléotide. L’ADN polymérase α intervient pour la formation de l’amorce D) Elle nécessite une endonucléase Vrai, pour former la brèche. E) Il y a création d’un site AP Vrai, une N-glycosidase va rompre la liaison N-glycosidique et entrainera donc la formation d’un site AP Réponses BDE

19 8) C ONCERNANT LA RÉPARATION PAR EXCISION DE NUCLÉOTIDE, (NER) QUELLES EST ( SONT ) LA ( LES ) PROPOSITION ( S ) INEXACTE ( S ) ? A. Elle est impliquée dans des maladies héréditaires, notamment dans la maladie Xeroderma pigmentosum B. Elle nécessite la reconnaissance de l’ADN néosynthétisé C. Elle intervient souvent lorsque des dimères de thymine apparaissent D. Elle nécessite l’intervention d’une hélicase puis d’une endonucléase qui va couper une trentaine de nucléotides E. C’est l’ADN polymérase β qui va effectuer la resynthèse

20 A) Elle est impliquée dans des maladies héréditaires, notamment dans la maladie xeroderma pigmentosum Vrai, ainsi que dans le syndrome de Cokayne et trichotiodystrophie B) Elle nécessite la reconnaissance de l’ADN néosynthétisé Faux, c’est RER qui nécessite la reconnaissance de l’ADN néosynthétisé C) Elle intervient souvent lorsque des dimères de thymine apparaissent Vrai, c’est NER qui va intervenir lors de la formation d’un dimère de thymine

21 D) Elle nécessite l’intervention d’une hélicase puis d’une endonucléase qui va couper une 30aine de nucléotides Vrai, il va y avoir excision de 30 nucléotides. E) C’est l’ADN polymérase β qui va effectuer la resynthèse Faux, c’est l’ADN polymérase ε ou δ qui va effectuer la resynthèse. Réponses BE

22 9) C ONCERNANT LES OPÉRONS LACTOSE, TRYPTOPHANE ET LA PROTÉINE CAP QUELLE ( S ) EST ( SONT ) LA ( LES ) PROPOSITION ( S ) EXACTE ( S ) ? A. Ce sont tous les 3 des protéines allostériques. B. Ils agissent tous sur un unique opéron bactérien qui leur est propre. C. Pour l'opéron tryptophane l'effecteur allostérique est aussi le produit final de la réaction enzymatique. D. L'opéron lactose est capable de se lier à un segment d'ADN en absence de tout effecteur allostérique. E. Autre réponse

23 A) Ce sont tous les 3 des protéines allostériques. Faux : un opéron est un gène ou groupe de gènes contrôlé par 1 ou 2 protéines régulatrices B) Ils agissent tous sur un unique opéron bactérien qui leur est propre. Faux, la protéine cap est une protéine régulatrice de la transcription qui va agir sur plusieurs opérons bactérien. C) Pour l'opéron tryptophane l'effecteur allostérique est aussi le produit final de la réaction enzymatique. Vrai D) L'opéron lactose est capable de se lier à un segment d'ADN en absence de tout effecteur allostérique. Faux : le répresseur de l'opéron lactose se lie à la séquence régulatrice et bloque la transcription sous forme spontanément inactive Réponse C

24 10) C ONCERNANT LES INTRONS ET LES EXONS QUELS SONT LES 2 RÉPONSES FAUSSES : A. Les exons sont en général plus grands que les introns. B. L'ARN pré-messager va subir l'excision de ses introns et l'épissage de ses exons. C. L'extrémité 5' de l'intron commence toujours par une « TATA box ». D. Le site de branchement qui va permettre l'épissage est constitué de la gauche vers la droite d'une purine, d'une adénine et d'une pyrimidine. E. Autre réponse

25 A) Les exons sont en général plus grands que les introns. Faux, c'est l'inverse. B) L'ARN pré-messager va subir l'excision de ses introns et l'épissage de ses exons. Vrai, on obtiendra ainsi un ARN messager mature. C) L'extrémité 5' de l'intron commence toujours par une « TATA box ». Faux, L'extrémité 5' commence par une Guanine suivie d'une Tyrosine dans 100% des cas. D) Le site de branchement qui va permettre l'épissage est constitué de la gauche vers la droite d'une purine, d'une adénine et d'une pyrimidine. Vrai, ce site de branchement se trouve environs 20 nucléotides avant l'extrémité 3' de l'intron. Réponses AC

26 11) Q UELLE EST LA PROPOSITION FAUSSE ? A. En amont du premier nucléotide transcrit on trouve des éléments de séquence permettant la liaison de l'ARN polymérase, ces éléments sont appelés des promoteurs. B. Les promoteurs forts sont plutôt riches en paires de base adénine/thymine. C. Malgré la présence de séquences consensus dans les promoteurs,ceux-ci gardent toujours une certaines variabilité. D. Les promoteurs forment des palindromes qui déterminent donc le sens de la liaison de l'ARN polymérase. E. Autre réponse

27 A) En amont du premier nucléotide transcrit on trouve des éléments de séquence permettant la liaison de l'ARN polymérase, ces éléments sont appelés des promoteurs. Vrai, ex:TATA box B) Les promoteurs forts sont plutôt riches en paires de base adénine/thymine. Vrai,ces 2 bases facilitent la dénaturation locale de l'ADN et donc la liaison de l'ARN polymérase.

28 C) Malgré la présence de séquences consensus dans les promoteurs,ceux-ci gardent toujours une certaines variabilité. Vrai, leur distance par rapport au site d'initiation peut aussi varier. D) Les promoteurs forment des palindromes qui déterminent donc le sens de la liaison de l'ARN polymérase. Faux, Lespromoteurs ne forment pas de palindrome maissont asymétriques ! Ce qui détermine bien le sens de liaison de l'ARN polymérase. Réponse D

29 12) Q UELLE ( S ) SONT LES 2 PROPOSITIONS JUSTES ? A. Dans chaque cellule, la grande majorité des gènes sont dans un état silencieux. B. Les Enhancers (=régions régulatrices distales) peuvent agir sur un promoteur différent de leur promoteur d'origine et peuvent élever fortement l'activité de transcription. C. Les facteurs de régulation de l'ADN se lient à ce dernier en dénaturant la structure hélicoïdale. D. Les protéines « Winged-helix » ne sont pas des protéines de liaison à l'ADN. E. Autre réponse

30 A) Dans chaque cellule, la grande majorité des gènes sont dans un état silencieux. Vrai B) Les Enhancers (=régions régulatrices distales) peuvent agir sur un promoteur différent de leur promoteur d'origine et peuvent élever fortement l'activité de transcription. Vrai, L'activité de transcription peut être 10 à 100 fois plus élevée.

31 C) Les facteurs de régulation de l'ADN se lient à ce dernier en dénaturant la structure hélicoïdale. Faux, Les facteurs de régulation se lient à l'ADN mais sans dénaturé la structure hélicoïdale !!Ceux sont les agents mutagènes qui vont dénaturer la structure de l'ADN et entrainer ainsi des lésions de cet dernière. D) Les protéines « Winged-helix » ne sont pas des protéines de liaison à l'ADN. Faux, justement ceux sont des protéines de liaison à l'ADN. Réponses AB

32 13) C ONCERNANT L ' ACTIVATION ET LA RÉPRESSION DE LA TRANSCRIPTION : QUELLE ( S ) EST ( SONT ) LA ( LES ) PROPOSITION ( S ) JUSTE ( S ) ? A. L'initiation de la transcription nécessite la mise en place d'un complexe « médiateur » qui recrute des protéines modifiant le chrome. B. Les histones vont être hydroxylés ce qui aura un effet activateur. C. Les histones sont chargés négativement. D. Toutes ces modifications enzymatiques de l'ADN sont irréversibles. E. Autre réponse

33 A) L'initiation de la transcription nécessite la mise en place d'un complexe « médiateur » qui recrute des protéines modifiant le chrome. Faux, le complexe « médiateur » recrute des protéines modifiant la chromatine !! B) Les histones vont être hydroxylés ce qui aura un effet activateur. Faux, Les histones vont être acétylés ce qui aura un effet activateur (car neutralisation des charges positives et dissociation de l'ADN)

34 C) Les histones sont chargés négativement. Faux, les histones sont chargés positivement et cette charge permet une interaction forte avec les groupements phosphate de l'ADN qui portent des charges négatives. D) Toutes ces modifications enzymatiques de l'ADN sont irréversibles. Faux, elles sont réversibles. E) Autre réponse Vrai Réponse E

35 14) C ONCERNANT L 'ARN POLYMÉRASE : A. Chez les Eucaryotes il n'y a qu'un seul type d'ARN polymérase. B. Chez les Eucaryotes on trouve l'ARN polymérase I qui est pré-ribosomique. C. Il y a toujours plusieurs milliers d'ARN polymérase par cellule. D. L'ARN polymérase des procaryotes a un poids moléculaire d'environ 600 kDa. E. Autre réponse

36 A) Chez les Eucaryotes il n'y a qu'un seul type d'ARN polymérase. Faux,c'est chez les procaryotes qu'il n'y qu'un seul type d'ARN polymérase. B) Chez les Eucaryotes on trouve l'ARN polymérase I qui est pré- ribosomique. Vrai C) La présence du facteur sigma est nécessaire pour l’élongation chez E.Coli Faux : Sigma est nécessaire pour l’initiation D) L'ARN polymérase des procaryotes a un poids moléculaire d'environ 600 kDa. Faux, il a un PM d'environ 400kDa. Réponse B

37 15) C ONCERNANT LE CHOLESTÉROL : Q UELLE EST LA PROPOSITION FAUSSE ? A. Il est formé de 27 carbones. B. Il n'a qu'un seul oxygène dans sa structure. C. C'est un sphingolipide de la famille des stérols. D. Le cholestérol une structure similaire aux hormones stéroïdes sexuelles. E. Autre réponse

38 A) Il est formé de 27 carbones. Vrai, la formule brute du cholestérol est C 27 H 46 O. B) Il n'a qu'un seul oxygène dans sa structure. Vrai cf A, La structure du cholestérol est à connaître par coeur !!

39 C) C'est un sphingolipide de la famille des stérols. Faux, C'est un lipide de la famille des stérols. D) Le cholestérol une structure similaire aux hormones stéroïdes sexuelles. Vrai ex : la progestérone Réponse C

40 16) P ARMI LES PROPOSITIONS SUIVANTES LAQUELLE OU LESQUELLES EST ( SONT ) JUSTE ( S )? Deux mutations du gène correspondant entrainent l'apparition sur l'ARNm d'un uracile (U) en position 12 et d'une adénine (A) en position 18. A. Ces deux mutations sont des transversions B. Ces deux mutations n'entrainent chacune que la modification d'un seul acide aminé C. Ces deux mutations entrainent l'apparition d'un codon stop prématuré en phase avec le codon initiateur D. La mutation en 12 résulte probablement de la désamination d'une cytosine qui était méthylée E. Autre réponse 5' - C C U A U G U C A A G C G A U A U G C U A U A A - 3'

41 5'- CCU AUG UCA AGU GAU AUA CUA UAA - 3' A) Ces deux mutations sont des transversions FAUX: Ce sont des transitions, purine remplacée par une purine (A --> G) et pyrimidine remplacée par une pyrimidine (C --> U) B) Ces deux mutations n'entrainent la modification que d'un seul acide aminé VRAI: La mutation en 18 est une mutation faux sens car il n'existe qu'un seul codon codant pour la methionine. C) Ces deux mutations entrainent l'apparition d'un codon stop prématuré en phase avec le codon initiateur FAUX: les codons stop sont UGA, UAA, UAG D) La mutation en 12 résulte probablement de la désamination d'une cytosine qui était méthylée VRAI: Une 5méthyl-cytosine désaminée donne une thymine qui au moment de la transcription deviendra uracile si elle est au niveau d'un dinucléotide CpG (ce qui est le cas) point chaud de mutation Réponses BD

42 17) C ONCERNANT LA BOUCLE ANTICODON, QUELLE EST LA PROPOSITION FAUSSE ? A. La séquence anticodon correspond à un triplet invariable CCA à l'extrémité 3' d'un ARNt B. L'appariement wobble en première position de l'anticodon permet de pallier la disparité entre le nombre de codons et le nombre d'acides aminés C. L'anticodon s'apparie de façon complémentaire et antiparallèle avec un codon de l'ARm D. Un anticodon 5'-GAU-3' peut être apparié de manière non canonique à un codon 5'-AUU-3' de l'ARNm E. Autre réponse

43 A) La séquence anticodon correspond à un triplet invariable CCA à l'extrémité 3' d'un ARNt FAUX: la séquence anticodon est portée par la boucle d'une structure en épingle à cheveux de l'ARNt, l'extrémité 3'-CCA correspond à la séquence d'ancrage de l'acide aminé B) L'appariement wobble en première position de l'anticodon permet de pallier la disparité entre le nombre de codons et le nombre d'acides aminés VRAI: l'hypoxanthine que l'on peut retrouver en position 1 de l'anticodon peut s'apparier avec U,A et C; l'appariement G=U également possible

44 C) L'anticodon s'apparie de façon complémentaire et antiparallèle avec un codon de l'ARm VRAI D) Un anticodon 5'-GAU-3' peut être apparié de manière non canonique à un codon 5'-AUU-3' de l'ARNm VRAI: possibilité d'appariement wobble (bancal) entre G et U Réponse A

45 18) C ONCERNANT L ' INITIATION DE LA TRADUCTION CHEZ LE PROCARYOTE, QUELLE EST LA PROPOSITION FAUSSE ? A. Elle débute par reconnaissance d'une séquence consensus située en amont du codon initiateur B. Elle peut être co-transcriptionelle C. Elle ne peut se produire sans l'ARNt N- formylméthionine D. Les tétracyclines sont des antibiotiques inhibiteurs de la traduction en empêchant la synthèse de l'acide folique E. Autre réponse

46 A) Elle débute par reconnaissance d'une séquence consensus située en amont du codon initiateur VRAI: il s'agit de la séquence de Shine-Dalgarno, cette séquence permet au ribosome de différencier le codon initiateur des autres codons AUG B) Elle peut être co-transcriptionelle VRAI (chez le procaryote! ) C) Elle ne peut se produire sans l'ARNt N-formylméthionine VRAI: La méthionine initiatrice nécessite un ARNt particulier formylable: ARNt F Met Une formyl-transférase permet la formylation du méthionyl-ARNt F Met à partir du N10 formyl tétrahydrofolate. Les ARNt M Met non formylables concernent les methionines internes D) Les tétracyclines sont des antibiotiques inhibiteurs de la traduction en empêchant la synthèse de l'acide folique FAUX: Il s'agit des sulfamides antibiotiques, les tétracyclines sont des inhibiteurs de la petite sous-unité (élongation)

47 19) C ONCERNANT LE GÉNOME HUMAIN, QUELLE EST LA PROPOSITION JUSTE ? A. C'est le plus petit génome eucaryote B. Il contient environ gènes codant pour des protéines C. Les séquences répétées représentent environ un tiers du génome D. Le nombre de gènes codant pour les protéines est proportionnel à la complexité de l'ADN de l'organisme E. Autre réponse

48 A) C'est le plus petit génome eucaryote FAUX: le génome de certaines fougères font 10x la taille du génome humain B) Il contient environ gènes codant pour des protéines VRAI: c'est le chiffre le plus réaliste C) Les séquences répétées représentent environ un tiers du génome FAUX: plus de la moitié 60% D) Le nombre de gènes codant pour les protéines est proportionnel à la complexité de l'ADN de l'organisme FAUX Réponse B

49 20) C ONCERNANT L ' ORGANISATION DU GÉNOME HUMAIN, QUELLE EST LA PROPOSITION JUSTE ? A. L’ensemble des séquences dispersées sont encore mobiles de nos jours B. Les transposons passent par une étape d'épissage de l'ARN avant d'être intégrée dans le génome C. Les LINES passent par une étape de transcritption reverse avant d'intégrer le génome D. Les ilot CpG sont en général méthylés pour les gènes actifs et déméthylés pour les gènes inactifs E. Autre Réponse

50 A. L’ensemble des séquences dispersées sont encore mobiles de nos jours Faux : elles l’ont été (c’est comme cela qu’elles se sont dispersées), mais ne le sont plus maintenant B. Les transposons passent par une étape d'épissage de l'ARN avant d'être intégrée dans le génome Faux : Les transposons font intervenir une enzyme : la transposase C. Les LINES passent par une étape de transcritption reverse avant d'intégrer le génome Vrai D. Les ilots CpG sont en général méthylés pour les gènes actifs et déméthylés pour les gènes inactifs Faux : c‘est l‘inverse. Ils sont méthylés pour les gènes inactifs, déméthylés pour les gènes actifs. Réponse C

51 21) C ONCERNANT LE CLONAGE MOLÉCULAIRE, QUELLES SONT LES RÉPONSES EXACTES ? A. Le clonage moléculaire permet d’obtenir un grand nombre de cellules ayant le même génome. B. L’étape de purification consiste à mélanger des cellules hôtes avec des molécules d’ADN en excès numérique. C. Cette molécule d’ADN est introduite dans la cellule hôte grâce à un ADN vecteur (plasmide par exemple) D. Les plasmides apportent au clone recombinant au moins un gène de résistance à un antibiotique. E. Autre réponse

52 A) Le clonage moléculaire permet d’obtenir un grand nombre de cellules ayant le même génome. Vrai : on obtient des clones B) L’étape de purification consiste à mélanger des cellules hôtes avec des molécules d’ADN en excès numérique. Faux : ce sont les cellules hôtes (bactéries …) qui sont en excès. Ainsi, on est sûr qu’il n’y a qu’une seule molécule d’ADN dans chaque cellule.

53 C) Cette molécule d’ADN est introduite dans la cellule hôte grâce à un ADN vecteur (plasmide par exemple) Vrai. Les ADN vecteurs sont des transporteurs qui véhiculent l’ADN à cloner et les maintiennent à l’intérieur des cellules hôtes. Ex : plasmides bactériens, bactériophages de type « I », cosmides, BAC et YAC … D) Les plasmides apportent au clone recombinant au moins un gène de résistance à un antibiotique. Vrai : c’est ce qui permet l’étape de sélection. On place toutes les cellules étudiées (les recombinées + celles en trop) dans un milieu contenant un antibiotique. Les cellules recombinées survivent, les cellules non transformées meurent. Réponses ACD

54 Q UESTION 22 : 5’ TGAAGGAATTCCTCAAG 3’ 3’ ACTTCCTTAAGGAGTTC 5’ On utilise pour cela l’enzyme de restriction Eco R I (Escherichia coli), qui réalise des coupures à extrémités cohésives en reconnaissant la séquence 5’ GAATTC 3’ Quelle(s) est(sont) la(les) réponse(s) exacte(s) ?

55 5’ TGAAGGAATTCCTCAAG 3’ 3’ ACTTCCTTAAGGAGTTC 5’ A. Suite à l’action de l’enzyme Eco R I sur l’ADN, on obtient les 2 fragments suivants : 5’ TGAAGGAA 3’et5’ TTCCTCAAG 3’ 3’ ACTTCCTT 5’3’ AAGGAGTTC 5’ B. Une transcriptase-reverse peut transcrire l’un de ces brins d’ADN en ARN messager. C. Le séquençage de cette molécule a pu être obtenu par électrophorèse. D. Cette molécule d’ADN peut se lier spontanément à un plasmide. E. Autre réponse

56 A. Suite à l’action de l’enzyme Eco R I sur l’ADN, on obtient les 2 fragments suivants : 5’ TGAAGGAA 3’et5’ TTCCTCAAG 3’ 3’ ACTTCCTT 5’3’ AAGGAGTTC 5’ Faux. Elle réalise des coupures cohésives (et pas franches). On obtient : 5’ TGAAGG 3’et5’ AATTCCTCAAG 3’ 3’ ACTTCCTTAA 5’3’ GAGTTC 5’ B. Une transcriptase-reverse peut transcrire l’un de ces brins d’ADN en ARN messager. Faux. Une transcriptase-reverse est une ADN polymérase ARN dépendante. Elle transcrit de l’ARN (génome viral par exemple) en ADN simple brin. La transcription (ADN en ARNm) se fait par une ARN polymérase ADN dépendante

57 C. Le séquençage de cette molécule a pu être obtenu par électrophorèse. Vrai Cf technique de Sanger : synthèse in vitro de copies raccourcies et radioactives du brin d’ADN étudié. D. Cette molécule d’ADN peut se lier spontanément à un plasmide. Faux. Cette réaction nécessite une ligase (et de l’ATP = consommation d’énergie). De plus, le plasmide (circulaire) doit d’abord être linéarisé par une enzyme de restriction. Réponse C

58 23) C ONCERNANT L ’ HYBRIDATION MOLÉCULAIRE, QUELLE EST LA COMBINAISON DE RÉPONSE ( S ) INEXACTE ( S ) ? 1. L’hybridation moléculaire fait intervenir des bactéries. 2. Elle intervient dans la technique du Western Blot. 3. L’hybridation in situ permet de détecter dans un tissu la présence d’ARN messagers. 4. Un ARN antisens peut être utilisé comme sonde moléculaire. A : 1+2B : 3+4C : 2+3D : E : 4F : Autre réponse

59 1. L’hybridation moléculaire fait intervenir des bactéries. Faux : - Dénaturer les brins d’ADN par chauffage (rupture des liaisons hydrogène) - Refroidir rapidement - Renaturer (augmenter la température progressivement : permet de reformer les liaisons hydrogènes entre les paires de bases) 2. Elle intervient dans la technique du Western Blot. Faux, un Western Blot permet l’analyse de protéine. On utilise pour cela le principe de reconnaissance entre antigène et anticorps (marqué). Rappel : Southern Blot : analyse d’ADN Northern Blot : analyse d’ARN Western Blot : analyse de protéines

60 3. L’hybridation in situ permet de détecter dans un tissu la présence d’ARN messagers. Vrai. On utilise pour cela une sonde moléculaire marquée. 4. Un ARN antisens peut être utilisé comme sonde moléculaire. Vrai : il peut s’hybrider à l’ARN messager. Réponse A : 1+2

61 24) O N SOUHAITE ÉTUDIER LE GÈNE CFTR DONT VOICI UN EXTRAIT DE SA SÉQUENCE : 5’ ATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTTTTCAGCTGGACCAGACCAATTT TGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCTGCTGA CAATCTATCTGAAAAATTGGAAAGAGA ATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCAT TAATGCCCTTCGGCGATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGGGAAGTC ACCAAAGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATAACAAGGAGGAAC GCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTATTGTGAGGACACTGCTCCTACACCC AGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATTTATAAGAAG ACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAA GTATTGGACAACTTGTTAGTCTCCTTTCCAAC AACCTGAACAAATTTGATGAAGGACTTGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTC 3’ On souhaite amplifier par PCR (Polymerase Chain Reaction) la séquence en gras. Parmi les molécules suivantes, de quelle(s) amorce(s) a-t-on besoin ?

62 D E QUELLE ( S ) AMORCE ( S ) A - T - ON BESOIN ? 1. 5’ ATGGGATAGAGAGCTGGCTT 2. 5’ TACCCTATCTCTCGACCGAA 3. 5’ TTCGGTCGAGAGATAGGGTA 4. 5’ AATAAAATAGATCTTGTGCC 5. 5’ TTATTTTATCTAGAACACGG 6. 5’ CCGTGTTCTAGATAAAATAA A : 1B : 2+3C : 2+4D : 1+5 E : 1+6F : Autre réponse Réponse D

63 On dispose de l’ADN double brin : 5’ ATGGGATAG ……………………………………ATAAAATAA 3’ 3’ TACCCTATC ……………………………………TATTTTATT 5’ 1 ère étape de la PCR : dénaturation : on sépare les 2 brins Brin 1 5’ ATGGGATAG ……………………………………ATAAAATAA 3’ 3’ TACCCTATC ……………………………………TATTTTATT 5’ Brin 2

64 2 ème étape : hybridation des amorces et synthèse d’ADN (de 5’ vers 3’) à partir de cette amorce Amorce ……… 3’ TACCCTATC< GGCACAAGATCTATTTTATT 5’ ……… 5’ ATGGGATAG………………………CCGTGTTCTAGATAAAATAA 3’……… ……… 3’ TACCCTATC………………………GGCACAAGATCTATTTTATT 5’……… 5’ ATGGGATAG >CCGTGTTCTAGATAAAATAA 3’……… Amorce n°1

65 Puis, si on reprend le brin synthétisé précédemment (parmi les 4 : celui tout en haut), et qu’on l’hybride à nouveau avec une amorce 1 : ……… 3’ TACCCTATC………………………………… GGCACAAGATCTATTTTATT 5’ 5’ ATGGGATAG-synthèse d’adn > Amorce 1 On obtient bien au final la séquence désirée (sans tous les nucléotides précédents/suivants) de très nombreuses fois : 5’ ATGGGATAG ……………………………………… CCGTGTTCTAGATAAAATAA 3’ On a utilisé les amorces 1 et 5 Réponse D

66 25) C ONCERNANT LES SONDES MOLÉCULAIRES, QUELLES SONT LES PROPOSITIONS EXACTES ? A. Un ADNc est une molécule d’ADN dont la séquence est identique à celle du gène concerné. B. Un cDNA est synthétisé in vitro et n’existe pas de façon naturelle. C. Pour cloner ce cDNA, on utilise des ADN vecteurs et des bactéries recombinantes. D. Un ARN antisens permet d’observer l’effet de la mutation KO du gène concerné. E. Autre réponse

67 A. Un ADNc est une molécule d’ADN dont la séquence est identique à celle du gène concerné. Faux. Il est synthétisé à partir de l’ARN messager et ne contient donc que les exons (et pas les introns) Pour obtenir un ADNc : - On part d’une population d’ARN m - On ajoute une transcriptase reverse (ADN polymérase ARN dépendante), des nucléotides et une amorce (ex : oligoTT = séquence de TTTTTTT) - L’amorce s’hybride avec l’ARNm au niveau du poly A (séquence AAAAAA, poly adénylation de l’extrémité 3’ des ARN, cf cours de M.Dollé) - Synthèse du brin d’ADN = ADNc

68 B. Un cDNA est synthétisé in vitro et n’existe pas de façon naturelle. Vrai Un cDNA est un ADNc double brin L’ADNc n’est pas naturel, donc le cDNA ne l’est pas non plus. Pour obtenir un cDNA : - On part de l’ADNc obtenu à la proposition A - On rajoute une ribonucléase qui hydrolyse le brin d’ARNm (précédemment utilisé comme matrice) - On ajoute une ADN polymérase, des nucléotides et une amorce - Synthèse du brin d’ADN complémentaire, à partir de l’ADNc

69 C. Pour cloner ce cDNA, on utilise des ADN vecteurs et des bactéries recombinantes. Vrai (cf méthode de clonage expliquée à la question précédente) D. Un ARN antisens permet d’observer l’effet de la mutation KO du gène concerné. Vrai. L’ARN anti sens s’hybride à l’ARN messager (ARN naturel issu de la transcription de l’ADN : il est dans le « bon sens »). Il bloque ainsi la traduction en protéine, et donc l’expression du gène. Réponses BCD

70 26) D ANS QUELLE ( S ) TECHNIQUE ( S ) DE BIOLOGIE MOLÉCULAIRE UTILISE - T - ON DES ENZYMES DE RESTRICTION ? A. Southern Blot B. Hybridation moléculaire C. PCR (Polymerase Chain Reaction) D. Construction de banques génomiques E. Autre réponse

71 S OUTHERN B LOT H YBRIDATION MOLÉCULAIRE PCR (P OLYMERASE C HAIN R EACTION ) C ONSTRUCTION DE BANQUES GÉNOMIQUES A UTRE RÉPONSE L’hybridation moléculaire nécessite une sonde moléculaire marquée. Un PCR nécessite une amorce (fragment composé d’une vingtaine de nucléotides) Réponses AD

72 27) C ONCERNANT LES TECHNIQUES DE BIOLOGIE MOLÉCULAIRE, QUELLE EST LA COMBINAISON DE RÉPONSE ( S ) EXACTE ( S ) ? 1. On peut réaliser un Southern Blot pour une recherche de paternité. 2. L'utilisation d'ADN vecteurs est indispensable dans la technique du Northern Blot 3. En insérant la séquence codante de l’insuline humaine dans un vecteur d’expression, une bactérie est capable de synthétiser cette hormone. 4. Le criblage de banques génomiques se fait à partir de fragments non chevauchants. A : 1B : 1+3C : 2+4D : E : 3+4 F : Autre réponse

73 1. On peut réaliser un Southern Blot pour une recherche de paternité. Vrai 2. L'utilisation d'ADN vecteurs est indispensable dans la technique du Northern Blot Faux 3. En insérant la séquence codante de l’insuline humaine dans un vecteur d’expression, une bactérie est capable de synthétiser cette hormone. Vrai 4. Le criblage de banques génomiques se fait à partir de fragments non chevauchants. Faux : les fragments doivent justement être chevauchants, pour réussi à reconstituer la séquence.

74 28) P ARMI LES PROPOSITIONS PRÉCÉDENTES, LAQUELLE ( LESQUELLES ) S ’ APPLIQUE ( NT ) AUX BANQUES DE C DNA ? 1. Elles contiennent tous les gènes d’un organisme. 2. Elles sont constituées de l’ensemble des bactéries recombinantes contenant les cDNA 3. Elles contiennent les séquences d’exons des gènes concernés. 4. Elles contiennent les séquences d’introns des gènes concernés. 5. Elles sont réalisées à partir de « contigs ». A : 1B : 2+3C : 2+3+5D : E : F : Autre réponse

75 B ANQUES DE C DNA 1. Elles contiennent tous les gènes d’un organisme. Faux : que les séquences des gènes exprimés 2. Elles sont constituées de l’ensemble des bactéries recombinantes contenant les cDNA Vrai 3. Elles contiennent les séquences d’exons des gènes concernés. Vrai 4. Elles contiennent les séquences d’introns des gènes concernés. Faux 5. Elles sont réalisées à partir de « contigs ». Faux

76 28) P ARMI LES PROPOSITIONS PRÉCÉDENTES, LAQUELLE ( LESQUELLES ) S ’ APPLIQUE ( NT ) AUX BANQUES GÉNOMIQUES ? 1. Elles contiennent tous les gènes d’un organisme. 2. Elles sont constituées de l’ensemble des bactéries recombinantes contenant les cDNA 3. Elles contiennent les séquences d’exons des gènes concernés. 4. Elles contiennent les séquences d’introns des gènes concernés. 5. Elles sont réalisées à partir de « contigs ». A : 1B : 2+3C : 2+3+5D : E : F : Autre réponse

77 1. Elles contiennent tous les gènes d’un organisme Vrai : les séquences transcrites ET les séquences régulatrices 2. Elles sont constituées de l’ensemble des bactéries recombinantes contenant les cDNA Faux : les cDNA ne contiennent pas toutes les séquences 3. Elles contiennent les séquences d’exons des gènes concernés. Vrai 4. Elles contiennent les séquences d’introns des gènes concernés. Vrai 5. Elles sont réalisées à partir de « contigs ». Vrai Contigs = fragments d’ADN chevauchants obtenus par l’action d’une enzyme de restriction sur l’ADN génomique

78 M ERCI DE VOTRE ATTENTION !! M ARDI 11 DÉCEMBRE : SÉANCE SUPPLÉMENTAIRE UE1 F ORUM, 19 H 15 – 21 H 15 S ALLES 113, 114, 209, 210, 211 ET 212


Télécharger ppt "T UTORAT UE1 : S ÉANCE N °4 Correction 5-6 Décembre 2012."

Présentations similaires


Annonces Google