La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

POLYMORPHISMES CARTE & LIAISON GÉNÉTIQUES Laurent VILLARD Inserm Unité 491 Faculté de Médecine de La Timone M1 Génétique des.

Présentations similaires


Présentation au sujet: "POLYMORPHISMES CARTE & LIAISON GÉNÉTIQUES Laurent VILLARD Inserm Unité 491 Faculté de Médecine de La Timone M1 Génétique des."— Transcription de la présentation:

1 POLYMORPHISMES CARTE & LIAISON GÉNÉTIQUES Laurent VILLARD Inserm Unité 491 Faculté de Médecine de La Timone M1 Génétique des Mammifères LUMINY 1

2 2 POLYMORPHISMES A quelle condition peut-on étudier la transmission des caractères héréditaires ?

3 La transmission des caractères ne peut être étudiée que si ceux-ci sont POLYMORPHES. L'ADN humain est polymorphe Il existe environ différences entre deux invidivus pris au hasard (0,1% de leur génome) ! 3 POLYMORPHISMES

4 Ces variations dans la séquence d'ADN n'ont pas de conséquence pathologiques. Les polymorphismes sont le résultat de "mutations". Mutation : changement permanent et transmissible dans le matériel génétique Ceci implique que "mutation" n'est pas synonyme de "pathologie" 4 POLYMORPHISMES

5 Ces variations de séquence peuvent avoir lieu dans les gènes hors des gènes avec une conséquence sans conséquence groupe sanguin couleur des yeux sans conséquence synonymes 5 POLYMORPHISMES

6 Ü RFLP Restriction Fragment Length Polymorphism MICROSATELLITES Ü SNP Single Nucleotide Polymorphisms 6 LES TYPES DE POLYMORPHISMES

7 Restriction Fragment Length Polymorphism Suite à la découverte des enzymes de restriction (1973), une technique dhybridation de sondes marquées va être développée (Southern blot, 1975) pour repérer un fragment de restriction particulier dans un mélange complexe dADN. En 1980, on découvre que certains fragments de restriction nont pas la même taille chez tous les individus… Pourquoi ? 7 LES RFLP

8 Restriction Fragment Length Polymorphism Site de coupure EcoRI GAATTC CTTAAG Pas de coupure en cas GACTTC de modification du site CTGAAG (il sagit souvent du polymorphisme dun seul nucléotide) 8 LES RFLP

9 électrophorèse Taille des fragments de restriction LES RFLP

10 électrophorèse + - Taille des fragments de restriction 10 LES RFLP

11 ADN PCR Digestion Enzymatique Électrophorèse Site de restriction Site variable Amorce PCR 1,2 : Homozygotes 3 : Heterozygote * * LES RFLP

12 Découverts en 1989, ce type de marqueurs polymorphe va petit à petit remplacer les RFLP. Il s'agit de séquences d'ADN constituées de motifs répétés avec 2, 3 ou 4 nucléotides : nnnnnnCACACACACACACACACACACACACAnnnnnnnn nnnnnnGTTGTTGTTGTTGTTGTTGTTGTTGTTnnnnnnnn nnnnnnATGGATGGATGGATGGATGGATGGATGGnnnnn nb variable de répétitions 12 LES MICROSATELLITES nb variable de répétitions

13 Les microsatellites sont des marqueurs multi-alléliques Allèle 1 …nnnnnnnnCACACACACACACACACAnnnnnnnnnnnn… Allèle 2 …nnnnnnnnnCACACACACACACACACACACACACAnnnnnnn… Allèle 3 …nnnnnnnnnnCACACACACACACACACACACAnnnnnnnn… 9 répétitions (CA) 13 répétitions (CA) 11 répétitions (CA) 13 LES MICROSATELLITES

14 Chromosome (CA) n variable (locus polymorphe) Fragments dADN amplifiés Électrophorèse Grands Petits CACACACACACA 6 allèles détectés 14 LES MICROSATELLITES

15 Les marqueurs multi-alléliques sont plus intéressants pour les applications médicales ou légales que les marqueurs bi- alléliques. Pourquoi ? 15 LES MICROSATELLITES

16 Le pourcentage d'hétérozygotie dans la population générale sera plus important que celui des marqueurs bi-alléliques. Locus bi-allélique : A1, A2 (n = 2) 3 génotypes possibles : A1A1, A1A2, A2A2 Fréquence des hétérozygotes = 1 - (n x f(A1) x f(A2)) = 1 - (2 x 0,5 x 0,5) = 0,5 50% d'hétérozygotes au maximum 16 LES MICROSATELLITES

17 Locus multi-allélique : A1, A2, A3, A4….. An (n allèles) Nombre de génotypes homozygotes = n Nombre de génotypes possibles = n x (n+1) / 2 Pour un marqueur à 8 allèles = 8 x (8+1) / 2 = 36 génotypes (avec seulement 8 génotypes homozygotes) Fréquence des hétérozygotes= 1 - (8 x 0,125 x 0,125) = 0,875 87,5% d'hétérozygotes au maximum 17 LES MICROSATELLITES

18 Single Nucleotide Polymorphisms Allèle A …AGCATAGCAGCAATCAGCGCAGCAGTCTCTCTTCGCAAGCA… …TCGTATCGTCGTTAGTCGCGTCGTCAGAGAGAAGCGTTCGT… Allèle B …AGCATAGCAGCAATCAGCACAGCAGTCTCTCTTCGCAAGCA… …TCGTATCGTCGTTAGTCGTGTCGTCAGAGAGAAGCGTTCGT… 18 LES SNP

19 La base de données des SNP : dbSNP Contenu au EspèceNombre de SNP distincts Homo sapiens Canis familiaris Gallus gallus Mus musculus Pan troglodytes LES SNP

20 Si un SNP modifie un site de restriction, il génère un RFLP. Déterminer les allèles présents à un locus = GÉNOTYPER Combien de génotypes possibles pour : Un RFLP ? Un microsatellite à n allèles ? Un SNP ? ! 20 LES SNP

21 Si un SNP modifie un site de restriction, il génère un RFLP. Déterminer les allèles présents à un locus = GÉNOTYPER Combien de génotypes possibles pour : Un RFLP ?3 (AA, AB, BB) Un microsatellite à n allèles ?n x (n+1) / 2 Un SNP ?3 (AA, AB, BB) ! 20 LES SNP

22 Il existe deux types principaux de cartes : les cartes génétiques - les cartes génétiques les distances sont exprimées en centimorgan (cM) les cartes physiques - les cartes physiques les distances sont exprimées en paires de bases (pb) kilobases (kb) = 1000 pb Mégabases (Mb) = 1000 kb 21 CARTOGRAPHIE

23 Elle est basée sur lobservation de la transmission des caractères héréditaires. Les distances génétiques sont le reflet de la fréquence de recombinaison. Pendant la méïose, les « crossing-over » provoquent léchange de matériel génétique entre chromosomes homologues. Plus deux gènes (deux marqueurs) sont proches, moins ils ont de chances dêtre séparés par un crossing-over et plus la distance génétique entre eux sera petite. ABC AB C 22 CARTOGRAPHIE GÉNÉTIQUE

24 Lorsque deux marqueurs sont suffisamment proches pour nêtre séparés quune fois sur 100, on fixe la distance génétique qui les sépare à 1 centimorgan (1 cM). Il sagit dune mesure équivalente à 1% de recombinaison. Si deux marqueurs ne sont pas « liés » (i.e. sils sont situés sur deux chromosomes différents) ils seront séparés (en moyenne) une fois sur deux. La fréquence de recombinaison maximale est donc de 50% (0,5). 23 CARTOGRAPHIE GÉNÉTIQUE

25 Létude des familles humaines permet de déterminer le mode de transmission des caractères héréditaires (pas forcément des maladies mais aussi de nimporte quel segment dADN polymorphe). 24 CARTOGRAPHIE GÉNÉTIQUE

26 25 Ces études permettent de déterminer les fréquences de recombinaison entre ces caractères et donc de construire une CARTE GÉNÉTIQUE sur laquelle ces caractères seront positionnés les uns par rapport aux autres. Pour être informatives, ces études doivent étudier beaucoup de méïoses, donc de grandes familles.

27 Les SNPs ou microsatellites étant polymorphes, leur ségrégation peut être observée dans des familles : p1 p2 m1 m CARTOGRAPHIE GÉNÉTIQUE

28 L'établissement et lutilisation d'une carte génétique permettent L'établissement et lutilisation d'une carte génétique permettent : 1. D'établir des points d'ancrage pour la carte physique 2. D'identifier la région (et le gène) responsable d'une maladie monogénique donnée 3. D'étudier certaines particularités de la méiose, telle que la variation de fréquence des recombinaisons : en fonction du sexe en fonction de la région du génome 27 CARTOGRAPHIE GÉNÉTIQUE

29 Première version (CRI, familles du CEPH) 403 marqueurs (RFLP), résolution 10 cM Seconde version (Généthon, familles du CEPH) 814 marqueurs (microsatellites), résolution 4,4 cM Troisième version (NIH, CEPH) 1676 marqueurs (microsatellites + RFLP), résolution 3 cM Quatrième version (Généthon) 2066 marqueurs (microsatellites), résolution 2,9 cM Cinquième version (Généthon) 5264 marqueurs (microsatellites), résolution 1,6 cM 28 CARTOGRAPHIE GÉNÉTIQUE

30 Les cartes disponibles ont principalement été construites en utilisant 40 grandes familles, collectées par le Centre dEtude du Polymorphisme Humain (CEPH, Paris). 3- observation des recombinaisons entre les marqueurs proches afin de confirmer leur ordre 2- calcul des fréquences de recombinaison entre les marqueurs 1- génotypage de tous les individus pour déterminer les allèles présents au marqueur étudié chez ces individus. 29 CARTOGRAPHIE GÉNÉTIQUE

31 30

32 Carte génétique basse résolution du chromosome 1 Nomenclature des marqueurs : D pour DNA N numéro du chromosome S pour Sequence XXX numéro dordre Pour le chromosome 1 D1S243 D1S163 etc… Pour le chromosome X DXS441 DXS1116 etc… 31 CARTOGRAPHIE GÉNÉTIQUE

33 LOD (Logarithm of the odds) SCORE (Z) Cest une valeur déterminée dans le cadre dune ANALYSE DE LIAISON GENETIQUE Il s'agit d'une mesure statistique. C'est le logarithme du rapport des probabilités entre l'hypothèse proposée (liaison génétique) et l'hypothèse contraire (pas de liaison). Z = log10 LRLR = liaison / non liaison ! 32 ANALYSE DE LIAISON GÉNÉTIQUE

34 Si le lod score est supérieur à 3 (c'est-à-dire que la liaison est mille fois plus probable que la non-liaison) on tranche, en général, dans le cas des maladies monogéniques autosomiques, en faveur de la liaison génétique. 33 ANALYSE DE LIAISON GÉNÉTIQUE

35 Les valeurs inférieures à -2 (100 chances pour 1 contre la liaison génétique) excluent une la liaison génétique. Une valeur de lod score égale ou supérieure à 2 est acceptée comme étant significative pour le chromosome X Non liaisonLiaisonAjouter des familles… Z34 ANALYSE DE LIAISON GÉNÉTIQUE

36 I II III A1/A2 A3/A4 A1/A3A5/A6 A3/A6 A3/A5 A1/A6 Recombinant A1/A5 35 ANALYSE DE LIAISON GÉNÉTIQUE Exemple : test de la liaison entre une pathologie et un marqueur microsatellite

37 1- Il faut fixer une fraction de recombinaison = 5% signifie que le gène responsable et le marqueur considéré resteront liés dans 95 % des méioses observées. Une recombinaison sera observée dans 5% des méioses. Cette valeur sappelle (théta). varie entre 0 (identité de position) et 0,5 (non liaison). Si on suppose que le gène responsable et le marqueur sont au même endroit, elle sera égale à 0. Sinon, on fixe une fraction de recombinaison : par exemple 5% 36 ANALYSE DE LIAISON GÉNÉTIQUE

38 2- Calcul de la probabilité de liaison Probabilité de liaison (non recombinaison) entre gène et marqueur Fraction de recombinaison de 5% = 0,95 Probabilité de liaison « au hasard » = 50% = 0,5 Rapport des probabilités (LR) avec les deux hypothèses = 0.95/0.5 = 1,9 donc un lod score Z = log10(LR) = 0,279 (pour un individu) 37 ANALYSE DE LIAISON GÉNÉTIQUE

39 Probabilité de non liaison (recombinaison) entre gène et marqueur Fraction de recombinaison de 5% =0,05 probabilité de non liaison « au hasard » = 50% = 0,5 Rapport des probabilités de non liaison (LR) avec les deux hypothèses = 0.05/0.5 = 0,1 donc un lod score Z = log10 (LR) = -1 (pour un individu) 38 ANALYSE DE LIAISON GÉNÉTIQUE 3- Calcul de la probabilité de non liaison

40 Dans cette famille avec 7 enfants (7 meioses) dont 1 recombinant : (6 x 0.279) + (1 x (-1)) = Z = pour = 0,05 au marqueur A3 39 ANALYSE DE LIAISON GÉNÉTIQUE I II III A1/A2 A3/A4 A1/A3A5/A6 A3/A6 A3/A5 A1/A6 Recombinant A1/A5

41 En combinant plusieurs familles il devient possible d'établir une éventuelle liaison entre le marqueur testé (connu, ici A) et le gène non connu (responsable de la pathologie) mais qui sera ainsi localisé si Z > 3. Les individus recombinants font chuter le lod score = beaucoup de gamètes recombinants indique que le gène et le marqueur ont peu de chance dêtre liés génétiquement… (- linfini à = 0) 40 ANALYSE DE LIAISON GÉNÉTIQUE

42 41 Recombination fraction Marker D7S484-Infinity D7S D7S D7S D7S D7S D7S422-Infinity D7S506-Infinity D7S2552-Infinity D7S494-Infinity D7S502-Infinity

43 Le projet HapMap vise à comparer la séquence du génome de différents individus pour identifier les régions où des variations génétiques sont partagées. Le projet est financé par les organismes publics de 6 pays. L'objectif est de mettre à disposition des chercheurs l'information qui leur permettra de mettre en évidence des liens entre variations génétiques et susceptibilité à certaines maladies. 42 LE PROJET HAPMAP

44 Populations étudiées : Idaban (Nigéria)30 trios (2 parents / 1 enfant) Tokyo (Japon)45 individus sans lien de parenté Beijing (Chine)45 individus sans lien de parenté Américains (USA) originaires d'Europe de l'Ouest et du Nord30 trios (2 parents / 1 enfant) 43 LE PROJET HAPMAP

45 Le projet HapMap veut identifier le maximum de SNP dans le génome humain et établir leurs cartes de répartition dans différentes populations. Cartographie de la diversité génétique de l'espèce humaine. Le projet HapMap identifie les haplotypes courants dans 4 populations. Il définit des SNP "marqueurs" qui identifient un haplotype. Ex : susceptibilité à l'hypertension ? Quels sont les SNPs hérités en commun chez tous les patients hypertendus ? Le(s) facteur(s) de susceptibilité doivent se trouver proche. On ne génotypera pas les 10,000,000 de SNP chez chaque individu. On connaît des associations préférentielles de marqueurs proches qui constituent des "haplotypes" de SNP, d'où le nom HapMap. 44 LE PROJET HAPMAP

46 Les données du projet HapMap permettent des études d'association à grande échelle pour différentes pathologies : cancer accidents vasculaires cérébraux maladies du coeur diabète hypertension… A terme traitements adaptés au profil génétique des individus ("pharmacogénomique") "variants" génétique associés à la longévité, à la résistance aux maladies ? développement de nouvelles thérapies ? 45 LE PROJET HAPMAP

47


Télécharger ppt "POLYMORPHISMES CARTE & LIAISON GÉNÉTIQUES Laurent VILLARD Inserm Unité 491 Faculté de Médecine de La Timone M1 Génétique des."

Présentations similaires


Annonces Google