La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Auguères Anne-Sophie Boulotte Nadine UE 106 : Diversité des Organismes Marins Master 1 BEM Giant Marseillevirus highlights the role of amoebae as a melting.

Présentations similaires


Présentation au sujet: "Auguères Anne-Sophie Boulotte Nadine UE 106 : Diversité des Organismes Marins Master 1 BEM Giant Marseillevirus highlights the role of amoebae as a melting."— Transcription de la présentation:

1 Auguères Anne-Sophie Boulotte Nadine UE 106 : Diversité des Organismes Marins Master 1 BEM Giant Marseillevirus highlights the role of amoebae as a melting pot in emergence of chimeric microorganisms Boyer et al., 2009

2 Conclusion Résultats et discussions Matériels et méthodes Introduction Connaissances actuelles et quelques définitions Virus = entité biologique qui se sert des métabolites de son hôte pour se multiplier Virion = particule virale NCLDV = Nucleocytoplasmic Large DNA Virus. 6 familles avant la découverte du Marseillevirus : Phycodnavirus, Poxvirus, Asfarvirus, Mimivirus, Iridovirus et Ascovirus. Question redevenue actuelle suite à la découverte des virus géants : un virus doit-il être considéré comme vivant ou non ?

3 Conclusion Résultats et discussions Matériels et méthodes Introduction Marseillevirus : virus géant à ADN qui infecte les amibes Forme icosaédrique (20 triangles équilatéraux) La capside mesure 250nm de diamètre Génome de 368kb (5 ème plus grand génome viral connu) correspondant à 457 gènes Amibes : organismes eucaryotes unicellulaires (Amoebobiontes), vivent en milieu aquatique.

4 Isolement de Marseillevirus : Pièces de métal introduites dans une tour de refroidissement à Paris Prélèvement dune pièce et dun échantillon deau chaque semaine (x52) Filtration du biofilm formé et de léchantillon deau à laide dun filtre de 0.22µm Filtrats mélangés dans une solution saline PAS et inoculés dans une culture dAcanthamoeba polyphaga (Amoebobionte) Caractérisation structurale de Marseillevirus : Utilisation de la microscopie électronique et de limmunofluorescence après congélation des virions de Marseillevirus dans de léthane liquide Séquençage et analyse du génome de Marseillevirus : Pyroséquençage Comparaison des séquences des protéines à laide de la base de données BLASTP Analyses phylogénétiques : maximum de vraisemblance et méthode de neighbor-joining Conclusion Résultats et discussions Matériels et méthodes Introduction

5 Temps infection t 0 t mint 0 + 6h Virions de Marseillevirus après phagocytose par une amibe Développement d'une usine à virions dans le cytoplasme vers le noyau de l'amibe 2μm Noyau Conclusion Résultats et discussions Matériels et méthodes Introduction

6 Marseillevirus : Représente une nouvelle famille de virus Regroupement fortement soutenu avec le taxon Iridovirus- Ascovirus 28 gènes sur 41 en communs avec le gène ancestral des NCLDV (Iyer et al., 2006) 0,5 Poxvirus Asfarvirus Phycodnavirus Mimivirus Marseillevirus Iridovirus Ascovirus 64 99, , ,58 Conclusion Résultats et discussions Matériels et méthodes Introduction Arbre basé sur la méthode de Maximum de vraisemblance Comparaison de 5 protéines universelles de la famille des grands virus nucléocytoplasmiques (Iyer et al., 2001)

7 Marseillevirus : Regroupé avec le taxon Mimivirus-Mamavirus Caractéristique notable : 17 gènes partagés avec le taxon Mimivirus-Mamavirus mais absents des autres NCLDV 0,5 Asfarvirus Poxvirus Marseillevirus Mamavirus Mimivirus Phycodnavirus Iridovirus Ascovirus Conclusion Résultats et discussions Matériels et méthodes Introduction Arbre basé sur la méthode de Neighbor-joining par comparaison dun répertoire de gènes (Wolf et al., 2002)

8 Phycodnavirus Marseillevirus Asfarvirus Poxvirus Iridovirus - Ascovirus Iridovirus Mimivirus Consensus strict en ne gardant que les nœuds soutenus par les deux méthodes Conclusion Résultats et discussions Matériels et méthodes Introduction Représentation graphique arbre ou réseau? Pas de renseignement sur le groupe externe Arbres non congruents et non compatibles

9 Grands virus nucléo plasmiques 11,2% (51) Bactéries et phages 10,7% (49) Amoebo- biontes 5,5% (25) Autres eucaryotes 7,4% (34) Origine incertaine 6,3% (29) Pourcentage du génome total Origines probables des gènes à partir de l'analyse des séquences Étude de 188 protéines de Marseillevirus qui présentent des homologies avec d'autres dans différentes banques de données (BLASTP). Hypothèse : transferts horizontaux de gènes (HGTs) à partir dau moins quatre sources. Conclusion Résultats et discussions Matériels et méthodes Introduction

10 Usine à Marseillevirus Autre virus Bactérie phagocytée Noyau HGT Amibe Schéma dune amibe et des interactions entre les différents organismes Organismes chimériques : virus issus de recombinaisons entre plusieurs génomes Conclusion Résultats et discussions Matériels et méthodes Introduction

11 Conclusion Amibe : permet un mélange de gènes par HGTs entre l'hôte eucaryote et ses divers virus, bactéries, parasites et symbiontes. Ce mélange semble produire des génomes chimériques tels que celui du Marseillevirus. Place du Marseillevirus au sein des NCLDV pas encore totalement définie Découverte du Marseillevirus très récente, mais il se pourrait quil soit retrouvé dans dautres écosystèmes, infectant dautres hôtes, comme cest le cas pour dautres NCLDV (Claverie et al., 2009). Résultats et discussions Matériels et méthodes Introduction

12 Références bibliographiques Boyer M., Yutin N., Pagnier I., Barrassi L., Fournous G., Espinosa L., Robert C., Azza S., Sun S., Rossman M.G., Suzan-Monti M., La Scola B., Koonin E.V., Raoult D., Giant Marseillevirus highlights the rôle of amoebae as a melting pat in emergence of chimeric organisms. Proceedings of the National Academy of Sciences 106(51) : Claverie J.M., Grzela R., Lartigue A., Bernadac A., Nietsche S., Vacelet J., Ogata H., Abergel C., Mimivirus and Mimiviridae : Giant viruses with an increasing number of potential hosts, including corals and sponges. Journal of Invertebrate Pathology 101 : Iyer L.M., Aravind L., Koonin E.V., Common origin of four diverse families of large eukaryotic DNA viruses. Journal of Virology 75(23) : Iyer L.M., Balagi S., Koonin E.V., Aravind L., Evolutionary genomics of nucleo-cytoplasmic large DNA viruses. Virus Research 117 :

13 Annexes

14 Tableau comparatif du Marseillevirus avec un rétrovirus (VIH) MarseillevirusVIH Taille250 nm80 – 120 nm Taille du génome368 kb10 kb Nombre de gènes4579

15 Polymérase ACCTTGAGTACCATCTAGGA AGATCCT dXMP dATP PPi ATP ApyraseATP sulfurylaseLuciférase Lumière Pyrogramme Intensité du signal lumineux dNTP incorporés Signal lumineux capté par le séquenceur ACTT Pyroséquençage Rapide Peu coûteuse Lecture directe de la séquence obtenue

16 Immunofluorescence indirecte Rapide Détection de protéines virales (antigènes) directement dans un échantillon grâce à des anticorps couplés à la fluorescéine Virions congelés de Marseillevirus Fixation des anticorps primaires Détection des anticorps secondaires


Télécharger ppt "Auguères Anne-Sophie Boulotte Nadine UE 106 : Diversité des Organismes Marins Master 1 BEM Giant Marseillevirus highlights the role of amoebae as a melting."

Présentations similaires


Annonces Google