La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Exercice. Une solution pure dADN est chauffée. On mesure labsorbance A (densité optique) à 260 nm à différente température. Les résultats suivants sont.

Présentations similaires


Présentation au sujet: "Exercice. Une solution pure dADN est chauffée. On mesure labsorbance A (densité optique) à 260 nm à différente température. Les résultats suivants sont."— Transcription de la présentation:

1 Exercice. Une solution pure dADN est chauffée. On mesure labsorbance A (densité optique) à 260 nm à différente température. Les résultats suivants sont obtenus : T°C A2600,3650,4000,5360,582 Comment appelle-t-on ce phénomène ? Que déduisez-vous des courbes suivantes en ce qui concerne les ADN 1, 2 et 3

2 Question. Donner le ou les noms des auteurs des découvertes de biologie moléculaire suivantes A.Elucidation de la structure chimique de lacides désoxyribonucléique. B. Identification des premiers ARN interférents. C. Découverte du code génétique. D. Mise en évidence du concept de lARN messager.

3

4 Tous les é l é ments suivants sont n é cessaires à la r é plication de l ADN sauf un, lequel ? A.Les d é soxynucl é otides tri-phosphates B.Le magn é sium C.LADN polym é rase D.Facteur d é longation E.Une amorce d ARN F. La cha î ne matrice

5 Définir en une phrase les mots suivants : Anticodon Codon non sens Epingle à cheveux Bactériophage

6 Soit le schéma ci-dessous représentant un tRNA et son anticodon. Quel sera lacide aminé porté par ce tRNA ? 35 ACC

7 Exercice. Soit la séquence dARNm suivante : 5AUGUCUGCUGUUAUUUGGUUUUUUGAAGAUAAAAAA Quelle est la conséquence sur le polypeptide codé par cet ARNm de linsertion dun C en 28 ème position et de la délétion du 10 ème nucléotide (par rapport à lextrémité 5) ?

8 Carte de plasmide

9 Analyse des produits de restriction : principes de lélectrophorèse : (-) (+) Gros fragment Petit fragment Distance de migration logPM Distance déterminée pour une bande étudiée

10 Exercice : Carte de restriction. On considère un fragment dADN. Combien de bandes obtiendra t-on, après électrophorèse, si ce fragment de restriction est digéré par un enzyme de restriction ne le clivant quen un seul site ?

11 Soit un ADN linéaire (2500 paire de bases) contenant un site de restriction unique pour chacun de ces enzymes : SmaI, BglII, et SacI. Après digestion enzymatique, les profils électrophorétiques sont les suivants : a.ADN + SmaI = 2 bandes (700 et 1800 pb) b.ADN + SacI = 2 bandes (250 et 2250 pb) c.ADN + SacI + SmaI = 3 bandes (250, 700 et 1550 pb) d.ADN + BglII= 2 bandes (1000 et 1500 pb) e.ADN + BglII+ SmaI = 3 bandes (300, 700 et 1500 pb) En déduire la carte de restriction de cet ADN.


Télécharger ppt "Exercice. Une solution pure dADN est chauffée. On mesure labsorbance A (densité optique) à 260 nm à différente température. Les résultats suivants sont."

Présentations similaires


Annonces Google