La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Bertrand JORDAN Informations débats 21 novembre 2006 Diversité génétique humaine et « races »

Présentations similaires


Présentation au sujet: "Bertrand JORDAN Informations débats 21 novembre 2006 Diversité génétique humaine et « races »"— Transcription de la présentation:

1 Bertrand JORDAN Informations débats 21 novembre 2006 Diversité génétique humaine et « races »

2 Bertrand JORDAN Informations débats 21 novembre 2006 La lecture du génome humain a révélé les trois milliards de lettres de notre patrimoine héréditaire Les techniques actuelles permettent de mesurer des différences génétiques entre personnes et populations Ces différences réintroduisent-elles l’idée de « races » humaines biologiquement différentes ?

3 Bertrand JORDAN Informations débats 21 novembre 2006 L’idée de race apparaît à la fin du 17 e (pourquoi à ce moment-là ?)

4 Bertrand JORDAN Informations débats 21 novembre 2006 Ernst Haeckel, Anthropogenie, 1874 L’appartenance des Africains à l’espèce humaine reste discutée jusqu’à la fin du 19 e

5 Bertrand JORDAN Informations débats 21 novembre 2006 Cela dure jusqu’au XX e siècle…

6 Bertrand JORDAN Informations débats 21 novembre 2006 Race : une notion floue et composite Au moins trois composantes : Ethnicité culturelle (langage, religion, coutumes…) Attitude de la société et des institutions (ex. USA) Caractères biologiques (couleur de la peau,traits…)

7 Bertrand JORDAN Informations débats 21 novembre 2006 Les races (version extrême) L’humanité est divisée en races Biologiquement et génétiquement distinctes Comportements caractéristiques et héréditaires Hiérarchie entre les races

8 Bertrand JORDAN Informations débats 21 novembre 2006 Une construction idéologique et sociale - qui s’appuie sur quelques signes physiques - qui prétend représenter une réalité biologique sous-jacente, radicale et immuable… - et qui sert en général à justifier l’ordre social existant.

9 Bertrand JORDAN Informations débats 21 novembre 2006 Après 1945 : rejet de la notion de « races inférieures » Révélation des crimes du nazisme, décolonisation, déségrégation aux Etats-Unis Impossibilité de prouver des différences d’ordre génétique Origine unique de l’homme moderne : Afrique il y a ans

10 Bertrand JORDAN Informations débats 21 novembre Le peuplement humain du monde à partir de l’Afrique

11 Bertrand JORDAN Informations débats 21 novembre 2006 La vision traditionnelle : du singe à l’homme

12 Bertrand JORDAN Informations débats 21 novembre 2006 La réalité telle qu’on l’appréhende aujourd’hui

13 Bertrand JORDAN Informations débats 21 novembre 2006

14 L’ADN entre en scène

15 Bertrand JORDAN Informations débats 21 novembre 2006 La lecture de l’ADN humain (trois milliards de lettres) nous a beaucoup appris

16 Bertrand JORDAN Informations débats 21 novembre 2006 Notamment la faible diversité génétique de l’espèce humaine 0,1% de différence entre l’ADN de deux êtres humains 0,4 à 0,8% entre groupes de chimpanzés ou de gorilles 1 à 1,5% entre l’homme et le chimpanzé

17 Bertrand JORDAN Informations débats 21 novembre 2006 D’où une conclusion un peu rapide « Nous sommes tous identiques à 99,9%, DONC les races n’existent pas » (et donc le racisme n’a pas de sens)

18 Bertrand JORDAN Informations débats 21 novembre 2006 Contre-arguments On distingue (en général) facilement un Asiatique d’un Africain ou d’un Européen 0,1% : 3 millions de différences entre deux personnes On peut être antiraciste sans soutenir que nous sommes « tous pareils » du point de vue biologique

19 Bertrand JORDAN Informations débats 21 novembre 2006 Questions Quelle est exactement la nature de la diversité génétique humaine ? Comment se répartit-elle dans et entre les différentes populations ? L’analyse d’un ADN « anonyme » donne-t-elle des informations sur le groupe ethnique ?

20 Bertrand JORDAN Informations débats 21 novembre 2006 Diversité humaine : les SNPs (Single Nucleotide Polymorphisms) Un SNP toutes les mille lettres environ dans l’ADN

21 Bertrand JORDAN Informations débats 21 novembre 2006

22 Les deux allèles d’un SNP Région du SNP Pop 1 Pop 2 A1 GTTACCTGGCATGGCACATTGCTTTAA 56% 85% A2 GTTACCTGGCATAGCACATTGCTTTAA 44% 15% SNP NB la plupart (99% ?) de ces différences n’ont pas d’effet physiologique

23 Bertrand JORDAN Informations débats 21 novembre 2006 Les SNPs définissent ils des groupes humains ? Q : Existe-t-il des allèles spécifiques pour certaines populations ? R : Pratiquement pas. Presque tous les allèles sont présents dans chaque population 80 à 90% de la variation génétique sont retrouvés à l’intérieur de chaque groupe géographique, 10 à 20% entre les groupes

24 Bertrand JORDAN Informations débats 21 novembre 2006 Les SNPs définissent ils des groupes humains ? Q : Certains allèles sont-ils nettement plus fréquents dans certaines populations ? R : Oui, c’est le cas pour 10% environ des SNPs

25 Bertrand JORDAN Informations débats 21 novembre 2006 Les deux allèles d’un SNP Région du SNP Pop 1 Pop 2 A1 GTTACCTGGCATGGCACATTGCTTTAA 56% 85% A2 GTTACCTGGCATAGCACATTGCTTTAA 44% 15% SNP

26 Bertrand JORDAN Informations débats 21 novembre 2006 Les SNPs définissent ils des groupes humains ? Malgré cette faible différence entre groupes, peut- on trouver des « assortiments » caractéristiques d’allèles ? En termes savants : la corrélation des allèles permet-elle de classer les individus en groupes ? Cela dépend des SNP choisis…

27 Bertrand JORDAN Informations débats 21 novembre 2006 Exemple d’analyse L’ADN de 84 personnes est analysé pour 8500 SNPs déjà répertoriés (et déjà étudiés dans différentes populations) On regarde si les résultats permettent de classer ces personnes en différents groupes

28 Bertrand JORDAN Informations débats 21 novembre 2006 Avec les 1000 SNPs les moins spécifiques :

29 Bertrand JORDAN Informations débats 21 novembre 2006 Avec les 1000 SNPs les plus spécifiques

30 Bertrand JORDAN Informations débats 21 novembre 2006 En somme… La grande majorité des marqueurs génétiques ne différencie pas entre les populations… Mais si l’on mesure un grand nombre de marqueurs choisis parmi les plus informatifs, cette distinction est possible (entre grands groupes géographiques)

31 Bertrand JORDAN Informations débats 21 novembre 2006 On peut définir des SNPs « ancestraux », caractéristiques des populations d’origine … et les employer pour étudier les populations actuelles (N.B. aux États-unis, la « race » est répertoriée lors des recensements, et est auto déclarée depuis 1970)

32 Bertrand JORDAN Informations débats 21 novembre 2006 Une seule goutte de sang…

33 Bertrand JORDAN Informations débats 21 novembre 2006

34 Recensement 2000 aux Etats-Unis

35 Bertrand JORDAN Informations débats 21 novembre 2006 l’ADN permet de rattacher une personne à un (ou plusieurs) groupes ancestraux Les groupes ancestraux ainsi définis recouvrent grosso modo les grandes « races » communément reconnues Ces groupements n’impliquent aucune hiérarchie Plus de 95% des SNP sont en dehors des gènes Mais certains SNPs influent sur le phénotype

36 Bertrand JORDAN Informations débats 21 novembre 2006 Un exemple de diversité génique en Europe : l’activité lactase à l’âge adulte

37 Bertrand JORDAN Informations débats 21 novembre 2006 Diversité mondiale : couleur de la peau

38 Bertrand JORDAN Informations débats 21 novembre 2006 Sélection pour la couleur de peau Sélection naturelle : protection contre le soleil, synthèse de la vitamine D Sélection sexuelle : critères de beauté au sein d’une société La sélection sexuelle peut être très efficace…

39 Bertrand JORDAN Informations débats 21 novembre 2006 La sélection sexuelle peut être très efficace (et donner des résultats assez bizarres) (tiré de Gould, « Ever since Darwin »)

40 Bertrand JORDAN Informations débats 21 novembre 2006 La sélection par les éleveurs différencie très rapidement les races de chiens (qui restent une seule espèce)

41 Bertrand JORDAN Informations débats 21 novembre 2006 La fréquence des maladies peut varier selon le groupe ethnique Hypertension (> in African-American populations) Skin cancer (> in European-American) Prostate Cancer (> in African-American) Lung Cancer (> in African-American) Osteoporosis (> in European-American) différences d’origine génétique ou sociale ???

42 Bertrand JORDAN Informations débats 21 novembre 2006 Différences et inégalités Entre individus Entre groupes humains Par rapport à quelle situation ?

43 Bertrand JORDAN Informations débats 21 novembre 2006 Au total L’humanité est très homogène mais on peut retrouver dans l’ADN les traces de l’origine géographique Les différences phénotypiques entre groupes sont modestes, pas forcément génétiques, et leur effet positif ou négatif peut dépendre de l’environnement L’ancienne notion de « race » est source de confusions, elle se prétend biologique alors qu’elle est essentiellement sociale

44 Bertrand JORDAN Informations débats 21 novembre 2006 Sans oublier que… L’égalité en droits de tous les hommes est une décision politique qui ne repose pas sur une identité biologique


Télécharger ppt "Bertrand JORDAN Informations débats 21 novembre 2006 Diversité génétique humaine et « races »"

Présentations similaires


Annonces Google