La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Vecteurs de Clonage Année universitaire 2012/2013 DR. OULDJAOUI AHMED.

Présentations similaires


Présentation au sujet: "Vecteurs de Clonage Année universitaire 2012/2013 DR. OULDJAOUI AHMED."— Transcription de la présentation:

1 Vecteurs de Clonage Année universitaire 2012/2013 DR. OULDJAOUI AHMED

2 A. Définitions Un vecteur est une séquence d'ADN permettant la propagation, la sélection, la modification d'une séquence d'ADN d'intérêt. En bref l'étude et la manipulation d'une séquence d'ADN isolée. Le clonage est l'action d'isoler et d'insérer dans un vecteur un fragment d'ADN d'intérêt pour le multiplier à l'identique. L'ADN génomique est le support physique de l'ensemble des gènes de la cellule. l'ADN complémentaire (ADNc) est la copie en ADN des ARNm.

3 B. Utilité Permet de conserver une séquence d'ADN donnée. Permet de la multiplier pour en accroître la quantité. Permet de la modifier pour y introduire des mutations, délétions. Permet de la réintroduire dans des cellules.

4 C. Principes Un Vecteur Circulaire Linéaire Une Cellule hôte Procaryote Eucaryote Un fragment d'ADN ADN génomique d'intérêt. ADNc

5 I - Propriétés des vecteurs de clonage capables de réplication autonome dans une cellule hôte donnée (origine de réplication de type procaryotique et/ou eucaryotique) possèdent un polylinker ou site multiple de clonage Possèdent des propriétés permettant la sélection de la cellule hôte (résistance ATB) supportent linsertion dun fragment dADN plus ou moins grand.

6 II – Principes généraux dutilisation dun vecteur - Préparation du vecteur - Préparation de lADN à insérer - Réalisation dun recombinant - Incorporation à lhôte

7 1. Obtention de lADN recombinant + traitement PAL

8 2. La ligation (ligature...) Une enzyme, la ligase, est capable de lier de façon covalente deux molécules dADN en une.

9 3.Différents vecteurs pour différentes utilisations VECTEURSHOTEINSERT (Kb) PlasmidesBactérie10 Phage lambdaBactérie25 CosmideBactérie45 Phage P1Bactérie100 BAC (bacterial artificial chromosome) Bactérie300 YAC (yeast artificial chromosome) Levure1000 Taille maximum approximative du fragment dADN qui peut être cloné dans chaque vecteur

10 4. Les plasmides comme vecteurs de clonage Molécule dADN de taille réduite, d'origine bactérienne Molécule dADN circulaire – taille 2kb à 5kb Peut accepter jusquà 10kb dADN exogène Peut être considérée comme un minichromosome capable de réplication autonome Confère la résistance à un ou plusieurs antibiotiques= sélection

11 5. Les classes de plasmides 5.1. Les plasmides de première génération : Ce sont les premiers à avoir été utilisés en génie génétique. Ce sont des plasmides à létat naturel, non modifiés au laboratoire. Il sagit des plasmides suivants : ColE1 RSF 2124 pSC Les plasmides de deuxième génération : Ce ne sont pas des plasmides naturels mais résultent de plusieurs transformations : plasmides "artificiels". La série la plus importante de ces plasmides est la série pBR 312 à pBR 322. Le plasmide pBR 322 est constitué de 4,4 Kb et possède deux gènes de résistance : un pour la tétracycline (TcR), lautre pour lamplicilline (ApR). il possède, en plus, 20 sites uniques pour les endonucléases de restriction dont 11 localisés sur les deux gènes de résistance.

12 Carte du plasmide pBR322

13 pUC8 ACGAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCACTG Polylinker pUC 9 ACGCCAAGCTTGGCTGCAGGTCGACGGATCCCCGGGAATTCACTG Polylinker polylinkers de pUC8 et pUC Les plasmides de troisième génération : La famille pUC : Ont une taille qui avoisine 2,6 Kb et ayant intégré les gènes de résistance à lampicilline (ApR) et lacZ. Un polylinker identique à celui du phage M13 est associé à lacZ. Les différents pUC (de pUC8 à pUC19) ne différent que par le nombre de nucléotides et lemplacement du polylinker

14 Les plasmides comme vecteur de clonage

15 De type procaryotique (bactéries): Cas dun vecteur plasmidique: lADN est introduit dans les bactéries traitées spécialement le plus souvent par choc thermique ou par choc électrique. 6. Introduction de lADN recombinant dans les cellules hôtes électroporateur

16 6.1. Identification des clones intéressants Dans ce cas les bactéries transformées avec le vecteur ne possédant pas ou possédant linsert sont sélectionnées un criblage est nécessaire

17 Amp R Tet R Amp R Tet S Clone intéressant 6.2. Criblage des clones intéressants pBR322

18 6.3. Criblage -screening- des clones intéressants Test blanc-bleu ( α -complémentation)

19 LES PHAGES Virus de bactérie-infectieux : Rendement +++ λ : 48 Kb λ : 48 Kb Les phages et les bactéries hôtes sont généralement mutées pour Les phages et les bactéries hôtes sont généralement mutées pour éviterle cycle de Lysogénie au profit du cycle lytique. éviter le cycle de Lysogénie au profit du cycle lytique. Grande partie non essentielle Grande partie non essentielle VECTEURS VECTEURS 2 Types : Insertion (λ zap, gt CHARON cDNA Insertion (λ zap, gt CHARON cDNA Faible capacité 10 Kb Délétion : substitution Délétion : substitution (Charon, EMBL, DASH, FIX…) (Charon, EMBL, DASH, FIX…) Partie non essentielle « stuffer » est délétée et remplacée : 25 Kb Sélection spi. Sélection spi.

20 7. Les phages comme vecteurs de clonage Phage = virus de bactéries

21

22 De type procaryotique: Cas dun vecteur phagique 7.1. Introduction de lADN recombinant dans les cellules hôtes

23 8. Les cosmides comme vecteurs de clonage

24 9. Les YACs comme vecteurs de clonage YAC : Yeast Artificial chromosome

25 10. Bacterial Artificial Chromosomes BAC 7.4kb parA, parB and repE sont des genes requis pour la stabilité du BAC. OriS est une origine de réplication CM : gène de résistance au chloramphenicol Avantages : – Grande capacité d'insertion – Facilité de manipulation (comme plasmide) – Hôte bactérien – Copie unique – Pas (peu) de réarrangement

26 III - APPLICATIONS DES VECTEURS - Clonage et amplification dune séquence dADN - Création des banques dADN génomiques et dADNc - Introduction dun gène dans des cellules, des plantes ou des organismes (animaux transgéniques) - Production dARN - Production de protéines codées par les gènes insérés

27 Banques dADN -Banques dADN génomique - Banques de cDNA

28 Principe du clonage (cas dune banque génomique)

29 Banque (librairie) dADN génomique

30 Comment définir si une banque est suffisamment grande pour espérer trouver un fragment dintérêt? Calcul afin de définir la probabilité de trouver une séquence donnée dans une banque.N=In(1-P)/In(1-f) N: nombre de recombinants P: probabilité désirée f: proportion de génome dans un seul recombinant Ex: 99% de probabilité davoir une séquence représentée dans une banque de fragments de 17kb dun génome eucaryote ( pb) N= In(1-0.99)/In(1-(1, / ))=8, colonies

31 Banque dADNc Le problème ici est lobtention de clone dit « full length ».

32 Obtention de lADN de lorganisme donneur A partir de lARN: Principe de la "reverse transcription":

33 Production de protéines Utilisation de vecteur dexpression

34 Production de protéines humaines à but thérapeutique - Facteur VIII de la coagulation dans lhémophilie A - Hormone de croissance - Insuline

35 Exemple de linsuline

36 -Bactéries : E. Coli premier hôte utilisé nombreux vecteurs plasmidiques connus et utilisables culture en masse dans les fermenteurs taux dexpression élevés (plusieurs g de protéine/litre) MAIS secrètent mal les protéines : éclatement des bactéries -pas de modifications post-traductionnelles -Levure saccharomyces cerevisiae modifications post traductionnelles MAIS pas de secrétion, moins bon rendement -Cellules CHO (chinese hamster ovary) culture de masse en bioréacteurs, protéines complexes MAIS cher et rendement plus faible CELLULES HÔTES

37 Transfert et clonage du gène de linsuline

38 MERCI POUR VOTRE ATTENTION


Télécharger ppt "Vecteurs de Clonage Année universitaire 2012/2013 DR. OULDJAOUI AHMED."

Présentations similaires


Annonces Google