La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

42 nm22 nm37 nm Virus de l'hépatite Bparticules videsVirus de l'hépatite D Ag HBs Ag HBc Ag HD s L polymérase ADN ARN.

Présentations similaires


Présentation au sujet: "42 nm22 nm37 nm Virus de l'hépatite Bparticules videsVirus de l'hépatite D Ag HBs Ag HBc Ag HD s L polymérase ADN ARN."— Transcription de la présentation:

1

2

3 42 nm22 nm37 nm Virus de l'hépatite Bparticules videsVirus de l'hépatite D Ag HBs Ag HBc Ag HD s L polymérase ADN ARN

4 ARN ANTIGÉNOMIQUE / codons de terminaison petite protéine grande protéine GENE DELTA codon d'initiation AUG 70% d'appariement ARN GÉNOMIQUE 688/ / / (Chen, PNAS, 1986; Kos, Nature 1986)

5 sérum chimpanzé Northern Blot foie marmotte 1,7 Kb J Gen Virol 1991 Génome nt pCDNA3-sHD pCDNA3-LHD IF anti-HD Protéines sHD et LHD

6 AAUAAA Rz génome RNA Pol II AAAAA antigénome p24+ RNA Pol editing ADAR-S

7 NOYAU R Réplication + _ Protéines denveloppe HBV Entrée Assemblage ARN-Protéines delta + Transport du Génome p27 ARNm viral (2) ( 2 ) CYTOPLASME Le cycle de réplication HDV ARN génomique Edition : Mutation 1012 A G ARN antigénomique ARNm viral (1) p24 ( 1 ) Golgi-RE Farnésylation Libération

8 Atteinte hépatique chronique stimulation de la fibrogenèse stimulation du cycle cirrhose cancer HAV HBV HCV HDV HEV HBV HCV HDV reconstruction de l architecture reconstruction cellulaire Atteinte hépatique aiguë Transmission HBV : intégration, X HCV : expression continue de gènes HDV : multifactoriel

9 Hépatite Delta Co-infection Hépatites aigües Hépatites fulminantes Guérison 60 à 80% 5 à 10% 15 à 20% 2 à 10% 70 à 90% 5% Cirrhose 70% Carcinome hépatocellulaire Surinfection Porteurs chroniques B Hépatites Chroniques Delta

10 MARQUEURS VIRAUX Ag Delta IgM Anti-HD ( Temps ) CIRRHOSE CANCER DU FOIE HEPATITE AIGUE HEPATITE CHRONIQUE ARN Delta Traitement IgG Anti-HD

11 HDV toujours associé à une infection HBV ?

12

13 HDV INHIBE LA REPLICATION DE LHBV Effet anti-transcriptionnel Compétition enveloppe Cytokines (MxA ?)

14 Inhibition du HBV par HDV p24 /p27 Enhancers 60% à 80% p24 2,8 p27 3 2,3 2,4 4 V. Williams, JFV Avril 2004

15 Transmission Verticale Parentérale Nosocomiale / Iatrogène Horizontale Sexuelle Mère -Enfant Enfant - Enfant Famille Personne à Personne Homosexuelle Hétérosexuelle Transfusion Activité Professionelle Usage de drogue IV, IN Tatouage, piercing Accidents dexposition au sang Hémodialyse, Actes invasifs... Alimentaire- Hydrique HDV Huitres, Coquillages Réseau hydrique

16 PREVALENCE EN ITALIE DU SUD DES MARQUEURS DELTA 23% 14,3% 8,3% (Gaeta et al Hepatology, 2000)

17 % % % similarité nucléotidique I Ubiquitaire III Pérou, Colombie Venezuela II Japon, Taïwan, Yakutie HDV GENOTYPES

18 Japon,Taïwan, Yakutie II I Ubiquitaire III Pérou,Columbie Vénézuela Wang, Nature, 1986; Imazeki, J Virol, 1990; Casey, PNAS, 1993, Wu J Gen Virol 1998, and many others

19 Columbia Peru2 Peru1 TW-2b Ya13 Ya29 Ya26 Ya63 Ya704 Taiwan3 W15 W5 Italy-A20 Cagliari Us1 Us2 Taiwan China Ya30 Ya51 Somalia Ya724 Nauru Lebanon Japan-S Ethiopia II III I A B 1679/1 genome R0 1280As900S HD gene HDV sequences phylogenetic analyses distance (R0) K2- NJ Ivaniushina et al, J Gen Virol 2001

20 1 : PCR CLASSIQUE 2 : PCR CONSENSUS 234 bp 400 bp Ivanushina et al., J Gen Virol, 2001 ARN HDV PAR RT-PCR

21 Angola1 Cameroun5 Republique Centre Africaine 1 Rep. Democratique du Congo1 Egypte2 Gabon1 Gambie1 Ghana1 Guinée2 Côte dIvoire4 Mali1 Republique du Congo1 Pologne1

22 1679/1 R1 R2 318S 345As sHD gene 960S 1150As R0 1280As900S RT- PCR amplification - R0 - Full length (R1 et R2) Cloning and sequencing - Big Dye Terminator Multiple Alignment (Clustal W1.8, ProAlign) Phylogenetic approaches - Distance (K2/GTR) (PAUP* 4b6) - MP (PAUP* 4b6) - ML (GTR+ )(PAUP* 4b6 / MetaPIGA) Stability of the topology - Bootstrap/ SOAP/ Proalign / MetaPIGA SEQUENCE AND PHYLOGENETIC ANALYSES

23 New African HDV prototypes Type I Type II TW-2b / Miyako/ L215 Type III dFr dFr dFr dFr dFr dFr African full-length HDV sequence mean percentage similarity compared to known HDV genotypes

24 R0 Full- length Radjef et al., J. Virol. 2004

25 SHD type I SHD type III Casey et al, J.Virol, Réplication virale - type III - Réplication virale + ARN VHD défectifs pour la synthèse de sHD type I Transcomplémentation Type I versus Type III

26 Radjef et al., J. Virol. 2004

27 dFr1843 dFr45 dFr644 dFr47 dFr73 dFr910 dFr2020 dFr48 VNZD8375 VNZD8624 VNZD8349Peru-1 L215 Miyako TW-2b Cagliari US-2 US-1 China Lebanon Somalia Nauru Ethiopia Taiwan3 TW2476 Japan-S Ya-6 Ya-62 Ya-26 HDV-1 HDV-3 HDV-2 HDV-4 HDV-5 HDV-6 HDV-7 sHD gene AFRICANCLADESAFRICANCLADES HDV-8

28 AFRICA HDV-6 HDV-5 HDV-7 HDV-8 HDV-1

29 Le genre Deltavirus : au moins 8 clades majeurs suggestion (1) HDV-1 HDV-8 HDV / HBV co-(epidemiological)-speciation ? 8 HDV clades versus 8 HBV genotypes HDV comme marqueur des migrations humaines ? HDV variabilité : radiation Africaine large suggérant une évolution ancienne ? DISCUSSION Robertson B et al., Arch. Virol. 1998, 143,

30 HDVHBV Clade 1 Ubiquitaire Asie Amerique de Sud Asie Africa/France HBV/D HBV/B (1,2) HBV/A HBV/C HBV/B (2) HBV/C Clade 3HBV/F (3) Clade 4 HBV/B (4) Clade 5 Clade 6 Clade 7 HBV/E (5) HBV/Aa Clade Flodgren 2000, Saudy 2003; 2 - Kao 2002; 3 - Casey 1996; 4 Moriyama 2003; 5 Gordien 2004

31 Réponse Fin de traitement (48 semaines) 6 mois près l'arrêt___ IFN (MU/s) 9 MU 3 MU0MU9 MU 3 MU0MU nombre de patients traités ALAT10* 4 1 7* 1 1 normales ARN du VHD négatif10* 5 0 6* 2 1 ALT normales et 7* ARN du VHD négatif Atteinte hépatique 8 5ND 5* 2 2 améliorée * amélioration significative par comparaison avec le groupe non traité. Farci P., et al., 1994

32 GUACGGCCGGUGUACGGCCGGU A G G G C U GUCCCAGCCGUCCCAGCC U C C UC C G U CGGCGG GCCGGCUGGGGCCGGCUGGG C A A C AUUCCGAGGGGAAUUCCGAGGGGA G U A U G C U C U C C G AGCGAGCG CAGGGUCAGGGU A C C I II III IV F2 GUACGGCUGGGCUGUACGGCUGGGCU G C A U U C U CCGACCUGGGCCGACCUGGG C A U C G A G A G A C C A GC G U A G C U C A C U G CUCCACCCUCCACC C U C U C G C UGGUGG GAGGGAGG AAUCGAAUCG G II III I IV R P Ribozyme anti-génomique Ribozyme génomique PCR Temps réel : amorces et sondes Le Gal et al., 2005

33 Quantitative RT-PCR: assay sensitivity 10 serial dilutions of 4 cDNA obtained from 4 different serum samples Amplification using both qualitative (R0) and quantitative assays ,0005,00010,000 Dilution factor 6,8002,3001, Nb of copies in 10µl cDNA

34 39 HDV-RNA positive sera Quantitative RT-PCR: consensus assay HDV-1 n = 23 HDV-7 n = 5 HDV-6 n = 4 HDV-5 n = 6 HDV-2 n = 1 n = HDV-1Other types HDV load (log 10 copies/ml)

35 Intérêt du suivi de la charge virale de HDV PCR qualitative 18 months PEG-IFN12 months PEG-IFN Charge virale (log 10 copies/ml)

36 Charge virale (log 10 copies/ml) PCR qualitative 18 months STD-IFNPEG-IFN Intérêt du suivi de la charge virale de HDV

37 - Interféron Pegylé 1 - Inhibiteurs de la farnésylation (FTI) Le Gal et al., 2004, submitted, 2 - Bordier et al., J Clin Invest, 2003

38 - Is there any clinical evidence of a severe prognosis occurring with a specific HBV-HDV association? - Could the introduction of an HDV clade to a specific HBV background with which it is not usually linked enhance liver disease? - Why are HBV/F and HDV-3, which are linked together in South America, the most divergent isolates? - Are the different HDV sHD and LHD proteins functionally clade-specific for replication and assembly, respectively? - Will recombination become a major evolutionary process for Deltavirus strains in the future? Questions

39 Mariama Abdou Dissou Affolabi Chakib Alloui Patricia Anaïs Yazid Baazia Samira Dziri-Mendil Maité Garcia-Rico Elyanne Gault Nasser Hawajri Nadjia Radjef Emmanuel Gordien Fréderic Le Gal Dominique Roulot Mathieu Tamby Virginie Williams Marianne Ziol Bactériologie, Virologie - Hygiène, CNR Hepatite delta Hôpital Avicenne, AP-HP EA 3406, Université Paris13 Bobigny, France Unit of Evolutionnary Genetics Free University of Brussels, Gosselies, Belgium Michel C Milinkovitch Univ. Medecine and Pharmacy Cluj, Romania Tudor Drugan, Cristina Drugan Influenzae Institute St Petersburg, Russia Valeria Ivaniushina Institut National de Transfusion Sanguine, Paris, France, U76 Camille Sureau Laboratoire de Virologie CHU dIstanbul Sibel Oymak, Selim Badur Physicians, France M Beaugrand J Bernuau L Bettan N Boyer D Capron C Castelneau N Ganne V Grando JM Guignard D Guyader C Féray M Karmochkine F Lacaille C Lenaerts C Mathieu P Marcellin G NKontchou C Pallier O Rosmorduc D Samuel JC Trinchet Université PARIS 13 NORD


Télécharger ppt "42 nm22 nm37 nm Virus de l'hépatite Bparticules videsVirus de l'hépatite D Ag HBs Ag HBc Ag HD s L polymérase ADN ARN."

Présentations similaires


Annonces Google