La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Projet I Vérifier la carte de restriction dune insertion dADN.

Présentations similaires


Présentation au sujet: "Projet I Vérifier la carte de restriction dune insertion dADN."— Transcription de la présentation:

1 Projet I Vérifier la carte de restriction dune insertion dADN

2 Objectifs Déterminer quel gène vous avez (Bioinfo) Déterminer quel gène vous avez (Bioinfo) Générer une carte théorique (Bioinfo) Générer une carte théorique (Bioinfo) Vérifier expérimentalement la carte Vérifier expérimentalement la carte Déterminer lorientation Déterminer lorientation

3 Cartographie des plasmides inconnus Vecteur pUC19 Vecteur pUC19

4 Clonage dans pUC19 X SCM Digéré avec X

5 Clonage dans pUC19 X X + Insertion

6 Déterminer le site dinsertion Couper avec X X X + Insertion

7 X Delimites la droite & la gauche Ex. Si Pst est le site dinsertion: Bam est à la gauche Si Xba est le site dinsertion, alors Bam est à la droite

8 Déterminer lorientation relative XXAA XXAA Orientation 1 Orientation 2

9 Projet II Mutagenèse dirigée de LacZ

10 Objectifs Utiliser le PCR pour faire lamplification et la mutagenèse du gène Lacz dans pUC19 Utiliser le PCR pour faire lamplification et la mutagenèse du gène Lacz dans pUC19 Utiliser le PCR pour ajouter des sites de restrictions appropriés aux extrémités du gène LacZ pour permettre le clonage Utiliser le PCR pour ajouter des sites de restrictions appropriés aux extrémités du gène LacZ pour permettre le clonage

11 Réplication & Amplification dADN La Réaction de la Polymérase en Chaîne

12 Polymérases 5…GTACT 3…CATGAATGCTGCATTTGCGGGCATTACTC…5 Polymérase Amorce -OH Extrémité 3OH TACGACGTAAACGCCCGTAATGAG Matrice dADN ou ARN

13 2 Types de Polymérases ADN: ADN dépendante ADN dépendante : Requiert une matrice ADN Fait la synthèse dADN Ex. Polymérase Taq ARN dépendante Requiert une matrice ARN Fait la synthèse dADN (ADNc) Ex. Transcriptase inverse

14 14 La Réaction de la Polymérase en Chaîne-PCR Réplication répétitive dune région donnée dADN Réplication répétitive dune région donnée dADN Permet lamplification exponentielle dune région donnée dADN Permet lamplification exponentielle dune région donnée dADN Augmente la représentation relative dune région dintérêt Augmente la représentation relative dune région dintérêt Permet lisolation dune région donnée dADN Permet lisolation dune région donnée dADN

15 PCR-1 ier Cycle Dénaturation (95 o C) Appariement des amorces (Tm) 5CATACCGTGGGGTGCA ……….. ACGCGTTGCGATGGCA3 3GTATGGCACCCCACGA ……….. TGCGCAACGCTACCGT5 5CCGTGGGGT3> <3GGAACGGTACCGT5

16 Extension (72 o C) CATACCGTGGGGTGCA ……….. ACGCGTTGCGATGGCA3 3GTATGGCACCCCACGA ……….. TGCGCAACGCTACCGT5 5CCGTGGGGT3> <3GGAACGGTACCGT5

17 PCR-2 e Cycle Appariement Dénaturation /Extension

18 PCR- Cycles Subséquents Seulement cette matrice est amplifiée de façon exponentielle : 2 n fois fois totale

19 Survol des Cycles du PCR Amorces: Amorces: Courte séquence de nucléotidiques simple brins complémentaires aux cibles Courte séquence de nucléotidiques simple brins complémentaires aux cibles nucléotides nucléotides Utilisée en excès comparativement à la cible afin de favoriser lappariement des amorces plutôt que lappariement des matrices Utilisée en excès comparativement à la cible afin de favoriser lappariement des amorces plutôt que lappariement des matrices

20 Survol des Cycles du PCR Appariement: Appariement: Température à laquelle les amorces sapparient aux séquences complémentaires Température à laquelle les amorces sapparient aux séquences complémentaires Dois être sous le Tm des amorces Dois être sous le Tm des amorces Dois être une température qui permet aux deux amorces de sapparier Dois être une température qui permet aux deux amorces de sapparier Habituellement entre o C Habituellement entre o C

21 Survol des Cycles du PCR Extension: Extension: Fait à la température optimale pour la polymérase ADN Fait à la température optimale pour la polymérase ADN Habituellement o C pour la polymérase Taq Habituellement o C pour la polymérase Taq

22 Polymérase Taq Isolé dune bactérie thermophile Isolé dune bactérie thermophile Thermus aquaticus Thermus aquaticus Stable à des températures élevées Stable à des températures élevées 95 o C - utilisée pour dénaturer lADN 95 o C - utilisée pour dénaturer lADN Aucune activité exonucléase Aucune activité exonucléase Pas dautocorrection Pas dautocorrection Possède une activité deoxynucléotidyl transférase Possède une activité deoxynucléotidyl transférase Activité polymérase indépendante dune matrice Activité polymérase indépendante dune matrice Ajoute dA aux extrémité 3OH libres Ajoute dA aux extrémité 3OH libres

23 23 Amorces Caractéristiques: Caractéristiques: Courts oligonucléotides complémentaires aux séquences qui bordent la région dintérêt Courts oligonucléotides complémentaires aux séquences qui bordent la région dintérêt Établis le point dinitiation de la réplication Établis le point dinitiation de la réplication Établis le point de terminaison de la réplication Établis le point de terminaison de la réplication

24 24 Conception dAmorces Autocomplémentarité: 5GGGGCCCC3 GGGGGGGG CCCCCCCC Complémentarité de la paire 5GGGGAAAA3 3CCCC TTTT5

25 25 Conception dAmorces Complémentarité 5 3…………….ATGGGTATTGGCC…………………..-5 Matrice CCATAACCGG-OH3 5CGA Complémentarité 3 3…………….ATGGGTATTGGCC…………………..-5 Matrice TACCCATAACC TA-OH3

26 26 Conception dAmorces Région dintérêt Bonne orientation Mauvaise orientation

27 27 Problème Vous désirez amplifier la séquence représentée par la boite. Quelle paire damorces est dans la bonne orientation pour accomplir ceci? Vous désirez amplifier la séquence représentée par la boite. Quelle paire damorces est dans la bonne orientation pour accomplir ceci? 5-AAAAAAAAAAAA GGGGGGGGGGGGG-3 1- AAAAAA 2- TTTTTT 3- GGGGGG 4- CCCCCC

28 28 Utilité du PCR Amplification et isolation dune région donnée en changeant sa représentation relative Amplification et isolation dune région donnée en changeant sa représentation relative Entre 100pb et 10Kpb Entre 100pb et 10Kpb Criblage pour déterminer la présence dune séquence dintérêt Criblage pour déterminer la présence dune séquence dintérêt Présence ou absence dun produit damplification Présence ou absence dun produit damplification Mutagenèse dirigée Mutagenèse dirigée Utilisé pour ajouter ou enlever des nucléotides sur la matrice originale Utilisé pour ajouter ou enlever des nucléotides sur la matrice originale


Télécharger ppt "Projet I Vérifier la carte de restriction dune insertion dADN."

Présentations similaires


Annonces Google