La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Formation continue en. en en Chapitre 3 Formation continue en Chapitre 3.

Présentations similaires


Présentation au sujet: "Formation continue en. en en Chapitre 3 Formation continue en Chapitre 3."— Transcription de la présentation:

1 Formation continue en

2 en

3 en Chapitre 3

4 Formation continue en Chapitre 3

5 La dystrophie myotonique de Steinert Formation continue en Chapitre 3

6 La dystrophie myotonique de Steinert présentation conçue par Dr. Daniel F. Schorderet Division de Génétique Médicale Unité de Génétique Moléculaire CHUV / Lausanne Formation continue en Chapitre 3 vers 1.0f

7 Historique Définition du syndrome Diagnostic clinique Génopathologie Diagnostic moléculaire Corrélation géno-clinique Le phénomène d'anticipation Traitement Nous allons passer en revue les points suivants:

8 Historique

9 années

10 1886 Steinert : description de la maladie Batten & Gibb : mise en évidence du caractère familial Historique années

11 Steinert : description de la maladie Batten & Gibb : mise en évidence du caractère familial Greenfield : cataracte Historique années

12 Steinert : description de la maladie Batten & Gibb : mise en évidence du caractère familial Greenfield : cataracte Curschmann : atteinte viscérale (atrophie tescticulaire, calvitie) Historique années

13 Steinert : description de la maladie Batten & Gibb : mise en évidence du caractère familial Greenfield : cataracte Curschmann : atteinte viscérale (atrophie tescticulaire, calvitie) Vanier : forme néonatale Historique années

14 Steinert : description de la maladie Batten & Gibb : mise en évidence du caractère familial Greenfield : cataracte Curschmann : atteinte viscérale (atrophie tescticulaire, calvitie) Vanier : forme néonatale Harley, Brook, Buxton et al découverte du gène Historique années

15 Historique Définition du syndrome Diagnostic clinique Génopathologie Diagnostic moléculaire Corrélation géno-clinique Le phénomène d'anticipation Traitement

16 Généralités: - La maladie de Steinert est une myopathie héréditaire autosomique dominante touchant les deux sexes, - sa fréquence est d'environ 1/8'000 personnes - son gène se situe sur le chromosome 19 (q13.3)

17 Cliniquement, on peut distinguer

18 la forme néonatale Cliniquement, on peut distinguer

19 la forme adulte la forme néonatale Cliniquement, on peut distinguer

20 la forme tardive Cliniquement, on peut distinguer la forme néonatale la forme adulte

21 la forme tardive la forme néonatale la forme adulte début après 50 ans clinique peu symptomatique souvent, on ne retrouve qu'une cataracte

22 la forme tardive la forme néonatale la forme adulte début après 50 ans clinique peu symptomatique souvent, on ne retrouve qu'une cataracte

23 la forme tardive la forme néonatale la forme adulte début variable myotonie (poignée de main !) fonte musculaire - régions temporales, - sterno-cléido-mastoidiens faiblesse musculaire - ptose palpébrale visage "coupé à la hache" insuffisance respiratoire troubles du rythme, bloc hypogonadisme perte des cheveux cholèlithiase cataracte EMG particulier

24 la forme tardive la forme néonatale la forme adulte début variable myotonie (poignée de main !) fonte musculaire - régions temporales, - sterno-cléido-mastoidiens faiblesse musculaire - ptose palpébrale visage "coupé à la hache" insuffisance respiratoire troubles du rythme, bloc hypogonadisme perte des cheveux cholèlithiase cataracte EMG particulier

25 la forme tardive la forme néonatale la forme adulte forme gravissime début néonatal hypotonie importante facies peu expressif décès fréquent transmission mère-enfant uniquement

26 la forme tardive la forme néonatale la forme adulte forme gravissime début néonatal hypotonie importante facies peu expressif décès fréquent transmission mère-enfant uniquement

27 Historique Définition du syndrome Diagnostic clinique Génopathologie Diagnostic moléculaire Corrélation géno-clinique Le phénomène d'anticipation Traitement

28 Le diagnostic clinique repose sur la présence d'une clinique évocatrice un EMG pathologique

29 L'examen EMG

30 EMG normal au repos

31

32

33

34

35

36 Que se passe-t-il si l'on donne une chiquenaude à une aiguille implantée dans un muscle normal ?

37 Muscle normal

38

39

40

41

42

43 Répétons cette analyse sur le muscle d'une personne souffrant d'une dystrophie de Steinert.

44

45 Muscle myotonique

46

47

48 Analysons un muscle normal et un muscle souffrant d'une dystrophie de Steinert.

49

50 Muscle normal Muscle myotonique

51 Muscle normal Muscle myotonique

52 Muscle normal Muscle myotonique Amplitude augmentée Amplitude normale

53 Muscle normal Muscle myotonique Relaxation rapide Relaxation lente

54 Les 2 caractéristiques électromyographiques sont donc :

55 Amplitude augmentée Les 2 caractéristiques électromyographiques sont donc :

56 Relaxation lente Amplitude augmentée

57 Historique Définition du syndrome Diagnostic clinique Génopathologie Diagnostic moléculaire Corrélation géno-clinique Le phénomène d'anticipation Traitement

58 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 1. Liaison au groupe sanguin Lutheran

59 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 1. Liaison au groupe sanguin Lutheran 2. Assignation de lutheran au chromosome 19 19

60 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ) Liaison au groupe sanguin Lutheran 2. Assignation de lutheran au chromosome Découverte de marqueurs de part et d'autre du gène ApoC1 ERCC1

61 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 1. Liaison au groupe sanguin Lutheran 2. Assignation de lutheran au chromosome Découverte de marqueurs de part et d'autre du gène 4. Affinement de cette région D195S63 D19S95

62 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 1. Liaison au groupe sanguin Lutheran 2. Assignation de lutheran au chromosome Découverte de marqueurs de part et d'autre du gène 4. Affinement de cette région 5. Découverte d'une sonde polymorphique et d'une anomalie liée à la maladie de Steinert pM10M6

63 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Une analyse de Southern avec cette sonde montre chez un individu normal des allèles de 9 et 10 Kb.

64 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Une analyse de Southern avec cette sonde montre chez un individu normal des allèles de 9 et 10 Kb. 10 Kb 9 Kb

65 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Une analyse de Southern avec cette sonde montre chez un individu normal des allèles de 9 et 10 Kb. 10 Kb 9 Kb

66 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Une analyse de Southern avec cette sonde montre chez un individu normal des allèles de 9 et 10 Kb. 10 Kb 9 Kb

67 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Comme ces allèles sont hérités on observe dans la population générale, des individus avec des allèles 9/10 (1); 10 Kb 9 Kb (1)

68 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 10 Kb 9 Kb (1) (2) Comme ces allèles sont hérités on observe dans la population générale, des individus avec des allèles 9/10 (1); 10/10 (2);

69 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 10 Kb 9 Kb (1) (2) (3) Comme ces allèles sont hérités on observe dans la population générale, des individus avec des allèles 9/10 (1); 10/10 (2); et 9/9 (3).

70 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Lorsqu'on pratique une analyse simi- laire chez un patient avec maladie de Steinert, on note que l'allèle 10 est plus grand. Cette augmentation de la région peut être petite (qq centaines ou importante, qq milliers de pb). 10 Kb 9 Kb N Steinert

71 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Une analyse similaire a montré que des patients avec maladie de Steinert ont une augmentation de la taille de l'allèle 10 Kb. Cette augmentation peut être petite ou très importante. 10 Kb 9 Kb N Steinert

72 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Une analyse similaire a montré que des patients avec maladie de Steinert ont une augmentation de la taille de l'allèle 10 Kb. Cette augmentation peut être petite ou très importante. 10 Kb 9 Kb N Steinert

73 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Une analyse similaire a montré que des patients avec maladie de Steinert ont une augmentation de la taille de l'allèle 10 Kb. Cette augmentation peut être petite ou très importante. 10 Kb 9 Kb N Steinert

74 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 19 ApoC1 ERCC1 D195S63 D19S95 pM10M6 Une analyse similaire a montré que des patients avec maladie de Steinert ont une augmentation de la taille de l'allèle 10 Kb. Cette augmentation peut être petite ou très importante. 10 Kb 9 Kb N Steinert

75 Comme c'est souvent le cas, le gène a été découvert par approches successives (cf chapitre 1, Outils de la génétique moléculaire ). 1. Liaison au groupe sanguin Lutheran 2. Assignation de lutheran au chromosome Découverte de marqueurs de part et d'autre du gène 4. Affinement de cette région 5. Découverte d'un polymorphisme et d'une anomalie liée à la maladie de Steinert 6. Anaylse moléculaire de cette mutation

76 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

77 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

78 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

79 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

80 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

81 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

82 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

83 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

84 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

85 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

86 Un gène, nommé MTPK (myotonic protein kinase), a été isolé dans cette région du chromosome 19 et séquencé. Sa séquence, comme dans le cas du syndrome de l'X fragile, montre une région instable composée de triplet (CTG)..... GAACGGGGCTCGAAGGGTCCTTGTAG CCGGGAATGCTGCTGCTGCTGCTGGG GGGATACAAGACCATTTCTTTCTTTCG GCCAGGCTGAGGCCCTGACGTGGATT GGGCAAACTGCAGGCCTGGGAAG....

87 Le nombre de ces groupes de trois bases, qu'on appelle triplets, varie dans la population. Cette région est donc polymorphique. Dans une population normale, le nombre de triplets varie de 5 à 40, avec un pic à 5 triplets et le reste allant de 6 à 40. Le gène MTPK

88 Le nombre de ces groupes de trois bases, qu'on appelle triplets, varie dans la population. Cette région est donc polymorphique. Dans une population normale, le nombre de triplets varie de 5 à 40, avec un pic à 5 triplets et le reste allant de 6 à 40. Le gène MTPK 5 < 40 50%

89 Le nombre de ces groupes de trois bases, qu'on appelle triplets, varie dans la population. Cette région est donc polymorphique. Dans une population normale, le nombre de triplets varie de 5 à 40, avec un pic à 5 triplets et le reste allant de 6 à 40. Le gène MTPK 5 < 40 50%

90 Lorsqu'on analyse des patients souffrant de maladie de Steinert, on remarque que le nombre de triplets présents sur le chromosome atteint va de 50 à plusieurs milliers. Le gène MTPK

91 Lorsqu'on analyse des patients souffrant de maladie de Steinert, on remarque que le nombre de triplets présents sur le chromosome atteint va de 50 à plusieurs milliers. Le gène MTPK > 50 > 1000

92 Lorsqu'on analyse des patients souffrant de maladie de Steinert, on remarque que le nombre de triplets présents sur le chromosome atteint va de 50 à plusieurs milliers. Le gène MTPK > 50 > 1000

93 Historique Définition du syndrome Diagnostic clinique Génopathologie Diagnostic moléculaire Corrélation géno-clinique Le phénomène d'anticipation Traitement

94 Le diagnostic moléculaire de la maladie de Steinert repose sur

95 La taille de la région instable

96 Le diagnostic moléculaire de la maladie de Steinert repose sur La taille de la région instable 2 allèles de < de 50 triplets: normal

97 Le diagnostic moléculaire de la maladie de Steinert repose sur La taille de la région instable 2 allèles de < de 50 triplets: normal 2 allèles avec 1 de plus de 50 triplets: mutation

98 Le diagnostic moléculaire de la maladie de Steinert repose sur La taille de la région instable 2 allèles de < de 50 triplets: normal 2 allèles avec 1 de plus de 50 triplets: mutation 1 allèle de < de 50 triplets:

99 Le diagnostic moléculaire de la maladie de Steinert repose sur La taille de la région instable 2 allèles de < de 50 triplets: normal 2 allèles avec 1 de plus de 50 triplets: mutation 1 allèle de < de 50 triplets: Analyse par Southern normale: normal

100 Le diagnostic moléculaire de la maladie de Steinert repose sur La taille de la région instable 2 allèles de < de 50 triplets: normal 2 allèles avec 1 de plus de 50 triplets: mutation 1 allèle de < de 50 triplets: Analyse par Southern normale: normal Analyse par Southern anormale: mutation

101 Historique Définition du syndrome Diagnostic clinique Génopathologie Diagnostic moléculaire Corrélation géno-clinique Le phénomène d'anticipation Traitement

102 Corrélation géno-clinique Les premières études montrent qu'il existe une corrélation directe entre la taille de la région instable et l'âge du début de la symptomatologie le degré de scolarisation

103 Hunter et al. ont analysé 106 patients qu'ils ont répartis selon la taille de la région variable du gène MTPK.

104 Hunter et al. ont analysé 106 patients qu'ils ont répartis selon la taille de la région variable du gène MTPK pb Taille < 1500 pb Kb Kb > 4.5 Kb

105 Hunter et al. ont analysé 106 patients qu'ils ont répartis selon la taille de la région variable du gène MTPK pb Taille < 1500 pb Kb Kb > 4.5 Kb Individus

106 Voici la répartition des patients en fonction de la taille de la zone instable et de l'âge du début des symptomes n = 23 patients pb n = 23 patients < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb Age [ans] N 60 jamais

107 Voici la répartition des patients en fonction de la taille de la zone instable et de l'âge du début des symptomes n = 23 patients pb n = 23 patients < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb Age [ans] N 60 jamais Apparition des symptomes dès la naissance

108 Voici la répartition des patients en fonction de la taille de la zone instable et de l'âge du début des symptomes n = 23 patients pb n = 23 patients < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb Age [ans] N 60 jamais Patients n'ayant présenté aucun symptome durant leur vie.

109 Voici la répartition des patients en fonction de la taille de la zone instable et de l'âge du début des symptomes n = 23 patients pb n = 23 patients < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb Age [ans] N 60 jamais

110 Voici la répartition des patients en fonction de la taille de la zone instable et de l'âge du début des symptomes n = 23 patients pb n = 23 patients < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb Age [ans] N 60 jamais

111 Corrélation : Taille et Début de la maladie n = pb n = 23 < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb N 60 jamais Voici la répartition des patients en fonction de la taille de la zone instable et de l'âge du début des symptomes Le collectif est trop petit pour parler de corrélations statistiques, mais il est intéressant de regarder la tendance: plus la taille est grande, plus le début de la maladie est précoce ! Age [ans]

112 Corrélation : Taille et Début de la maladie n = pb n = 23 < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb N 60 jamais Voici la répartition des patients en fonction de la taille de la zone instable et de l'âge du début des symptomes Le collectif est trop petit pour parler de corrélations statistiques, mais il est intéressant de regarder la tendance: plus la taille est grande, plus le début de la maladie est précoce ! Age [ans]

113 Voici la répartition de ces mêmes patients en fonction de la taille de la zone instable et du degré de scolarisation n = 23 patients pb n = 23 patients < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb Niveau classe spéciale redoublé moyen avancé

114 Voici la répartition de ces mêmes patients en fonction de la taille de la zone instable et du degré de scolarisation n = 23 patients pb n = 23 patients < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb Niveau classe spéciale redoublé moyen avancé

115 Voici la répartition de ces mêmes patients en fonction de la taille de la zone instable et du degré de scolarisation n = 23 patients pb n = 23 patients < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb Niveau classe spéciale redoublé moyen avancé Le collectif est trop petit pour parler de corrélations statistiques, mais il est intéressant de regarder la tendance: plus la taille est grande, plus les problèmes scolaires sont importants!

116 Voici la répartition de ces mêmes patients en fonction de la taille de la zone instable et du degré de scolarisation n = 23 patients pb n = 23 patients < 1.5 Kb n = 35 patients Kb n = 18 patients Kb n = 7 patients > 4.5 Kb Niveau classe spéciale redoublé moyen avancé Le collectif est trop petit pour parler de corrélations statistiques, mais il est intéressant de regarder la tendance: plus la taille est grande, plus les problèmes scolaires sont importants!

117 Historique Définition du syndrome Diagnostic clinique Génopathologie Diagnostic moléculaire Corrélation géno-clinique Le phénomène d'anticipation Traitement

118 Le phénomène d'anticipation se déclare de plus en plus tôt ou que la symptômatologie soit de plus en plus grave Il y a phénomène d'anticipation lorsque, de générations en générations, une maladie

119 Le phénomène d'anticipation se déclare de plus en plus tôt ou que la symptômatologie soit de plus en plus grave Il y a phénomène d'anticipation lorsque, de générations en générations, une maladie

120 Le phénomène d'anticipation La maladie de Steinert représente l'exemple classique d'un tel phénomène.

121 Le phénomène d'anticipation La maladie de Steinert représente l'exemple classique d'un tel phénomène. Exemple

122 Le phénomène d'anticipation La maladie de Steinert représente l'exemple classique d'un tel phénomène. Un individu présente une cataracte à l'âge de 70 ans. Exemple

123 Le phénomène d'anticipation La maladie de Steinert représente l'exemple classique d'un tel phénomène. Un individu présente une cataracte à l'âge de 70 ans. Sa fille présente une maladie de Steinert typique avec début dans la trentaine. Exemple

124 Le phénomène d'anticipation La maladie de Steinert représente l'exemple classique d'un tel phénomène. Un individu présente une cataracte à l'âge de 70 ans. Sa fille présente une maladie de Steinert typique avec début dans la trentaine. Quelques années avant son diagnostic, elle a accouché d'un enfant qui est décédé d'une forme congénitale de maladie de Steinert. Exemple

125 Le phénomène d'anticipation Habituellement, l'analyse d'une telle famille se faisait de "bas en haut". La survenue d'un enfant avec maladie de Steinert congénitale faisait rechercher ce diagnostic chez sa mère, puis chez un des ses grand-parents.

126 Le phénomène d'anticipation Habituellement, l'analyse d'une telle famille se faisait de "bas en haut". La survenue d'un enfant avec maladie de Steinert congénitale faisait rechercher ce diagnostic chez sa mère, puis chez un des ses grand-parents. Il était donc tentant de parler d'un biais de recrutement.

127 Le phénomène d'anticipation Habituellement, l'analyse d'une telle famille se faisait de "bas en haut". La survenue d'un enfant avec maladie de Steinert congénitale faisait rechercher ce diagnostic chez sa mère, puis chez un des ses grand-parents. Il était donc tentant de parler d'un biais de recrutement. L'analyse moléculaire d'une telle famille montre pourtant que ce phénomène d'anticipation a une base moléculaire.

128 Exemple Voici l'analyse de Southern pratiquée dans la famille de notre exemple Contrôle Kb 10 Kb On peut voir que la taille de la région instable s'accroît d'une génération à l'autre.

129 Exemple Contrôle Kb 10 Kb On peut voir que la taille de la région instable s'accroît d'une génération à l'autre. Voici l'analyse de Southern pratiquée dans la famille de notre exemple

130 Exemple Contrôle Kb 10 Kb On peut voir que la taille de la région instable s'accroît d'une génération à l'autre. Voici l'analyse de Southern pratiquée dans la famille de notre exemple

131 Exemple Contrôle Kb 10 Kb On peut voir que la taille de la région instable s'accroît d'une génération à l'autre. Voici l'analyse de Southern pratiquée dans la famille de notre exemple

132 Historique Définition du syndrome Diagnostic clinique Génopathologie Diagnostic moléculaire Corrélation géno-clinique Le phénomène d'anticipation Traitement

133 Le traitement Il n'existe pas actuellement de traitement étiologique de la maladie.

134 Le traitement Il n'existe pas actuellement de traitement étiologique de la maladie. Mais le médicament de choix contre la myotonie est la mexilétine

135 Le traitement Il n'existe pas actuellement de traitement étiologique de la maladie. Mais le médicament de choix contre la myotonie est la mexilétine D'autres médicaments comme la carbamazépine, l'acétazolamide, la quinine voir même la diphenylhydantoïne peuvent également avoir une action.

136 Le traitement symptômatique

137 Les tentatives de corrections symptômatiques visent à pallier aux désordres associés :

138 Le traitement symptômatique Les tentatives de corrections symptômatiques visent à pallier aux désordres associés : - traitement chirurgical de la cataracte

139 Le traitement symptômatique Les tentatives de corrections symptômatiques visent à pallier aux désordres associés : - traitement chirurgical de la cataracte - appareillage en cas de trouble du rythme cardiaque

140 Le traitement symptômatique Les tentatives de corrections symptômatiques visent à pallier aux désordres associés : - traitement chirurgical de la cataracte - appareillage en cas de trouble du rythme cardiaque - administration d'hormones si nécessaire

141 Le traitement génétique

142 En attendant une éventuelle thérapie génique, le conseil génétique reste la seule action possible.

143 Le traitement génétique En attendant une éventuelle thérapie génique, le conseil génétique reste la seule action possible. Il se base sur les faits suivants:

144 Le traitement génétique En attendant une éventuelle thérapie génique, le conseil génétique reste la seule action possible. Il se base sur les faits suivants: la maladie est autosomique dominante

145 Le traitement génétique En attendant une éventuelle thérapie génique, le conseil génétique reste la seule action possible. Il se base sur les faits suivants: la maladie est autosomique dominante un diagnostic moléculaire est possible

146 Le traitement génétique En attendant une éventuelle thérapie génique, le conseil génétique reste la seule action possible. Il se base sur les faits suivants: la maladie est autosomique dominante un diagnostic moléculaire est possible le diagnostic prénatal est possible

147 Le traitement génétique En attendant une éventuelle thérapie génique, le conseil génétique reste la seule action possible. Il se base sur les faits suivants: la maladie est autosomique dominante un diagnostic moléculaire est possible le diagnostic prénatal est possible même s'il n'existe pas de corrélation directe avec la taille de l'amplification lorsque celle-ci est faible, une forte amplification est associée avec une maladie cliniquement évidente

148 Le traitement génétique En attendant une éventuelle thérapie génique, le conseil génétique reste la seule action possible. Il se base sur les faits suivants: la maladie est autosomique dominante un diagnostic moléculaire est possible le diagnostic prénatal est possible même s'il n'existe pas de corrélation directe avec la taille de l'amplification lorsque celle-ci est faible, une forte amplification est associée avec une maladie cliniquement évidente Les bénéfices d'un diagnostic "négatif" (l'enfant ne sera pas atteint) ne sont pas négligeables.

149 Ce diaporama a été conçu avec l'aide financière de SERONO S.A. (c) Copyright, D.Schorderet, 1994


Télécharger ppt "Formation continue en. en en Chapitre 3 Formation continue en Chapitre 3."

Présentations similaires


Annonces Google