La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

DIAGNOSTIC D'UNE INFECTION BACTERIENNE. Généralités  DIAGNOSTIC DIRECT : mise en évidence de la bactérie elle- même, donc finalement de sa culture ou.

Présentations similaires

Présentation au sujet: "DIAGNOSTIC D'UNE INFECTION BACTERIENNE. Généralités  DIAGNOSTIC DIRECT : mise en évidence de la bactérie elle- même, donc finalement de sa culture ou."— Transcription de la présentation:


2 Généralités  DIAGNOSTIC DIRECT : mise en évidence de la bactérie elle- même, donc finalement de sa culture ou isolement qui permettra l'identification ultérieure ainsi que de préciser sa sensibilité aux antibiotiques (antibiogramme).  DIAGNOSTIC INDIRECT : mis en évidence de la réponse de l'organisme à l'infection par la présence d'anticorps spécifiques, le plus souvent sériques ou plus rarement par une réponse d’hypersensibilité, dite allergique.

3 Examen direct : Demande  Important: Identification du patient par son nom, son prénom, sa date de naissance...  Il existe une procédure standard de recherche de cellules et de germes, d'où l'appellation suivante : "Examen cytobactériologique des urines ou ECBU".  Le clinicien ne devra jamais oublier d'indiquer toute demande ou recherche particulière, en raison de l'utilisation de milieux spéciaux.

4 Examen direct : Examen macroscopique  Toute infection bactérienne s'accompagne, outre la présence de bactéries, de signes biologiques liés à l'inflammation avec l'éventuelle présence de leucocytes.  Ces éléments peuvent entrainer au delà d'un seuil, une modification visuelle, clairement perceptible à l'oeil nu, qui signe une anomalie patente. Divers éléments sont alors obtenus comme le montrent les exemples suivants: l Trouble, hématurique, coloration anormale, odeur et consistance.

5 Examen direct : Examen microscopique, état frais  Etat frais: l une préparation est obtenue avec le dépôt d'une goutte entre lame et lamelle, puis on observe au microscope: u Présence éventuelle de bactéries (coque, diplocoque, chainette, coccobacille, bacille...), u le type de mobilité.  Evaluation des cellules avec une appréciation semi-quantitative (rares, peu nombreux, nombreux, très nombreux...) ou mieux quantitative, exprimée par nombre d'éléments / mm 3 ou ml.

6 Examen direct : Examen microscopique, après coloration  Coloration de Gram permet de distinguer les bactéries colorées en violet (G+) de celles en rose (G-).

7 Examen direct : premières conclusions  Les éléments récoltés de l'examen macroscopique et surtout microscopique fournissent souvent des arguments diagnostiques de très forte présomption.  La culture ou l'isolement de l'agent causal sera, cependant, essentielle. Elle permettra l'identification ultérieure mais aussi de préciser sa sensibilité aux antibiotiques (Antibiogramme).  Le diagnostic indirect sera quelquefois le seul recours diagnostique possible dans quelques maladies comme la syphilis.

8 Culture - Isolement  Divers milieux sont utilisés qui doivent satisfaire les besoins nutritifs et énergétiques des bactéries à cultiver. l En pratique, sont utilisés plusieurs milieux solides (gélosés) avec une technique particulière d'ensemencement (isolement orthogonal ou en cadran) permettant l'isolement de clones bactériens sous la forme de colonies (de l'ordre de 106 bactéries).

9 Culture: Exemples de milieux solides coulés en boîte de pétri selon le produit pathologique et la demande  Pus, liquides de ponction : milieux enrichis au sang, milieu sélectif (Chapman, ou sur demande: Loewenstein-Jensen)  Expectoration : milieux enrichis au sang (frais, cuit), milieu sélectif (Chapman; Drigalski ou sur demande: Lowenstein-Jensen)  Urines : milieu sélectif (Drigalski), milieu polyvalent pour bactéries G+ et G-.  Selles (coproculture): milieux sélectifs (Drigalski et SS pour entérobactéries telles Salmonella et Shigella,

10 Culture: Exemples de milieux liquides  L'usage de milieux liquides est limité en raison de l'absence possible d'isolement.  Sang, pus, liquides de ponction : milieux enrichis (flacons pour hémoculture,.....  Selles (coproculture): milieu sélectif (Muller-Kauffman).

11 Culture : Incubation  Après ensemencement, mise en incubation dans une étuve ou une chambre chaude à 37°C: l en atmosphère ambiante (culture aérobie), l en l'absence d'oxygène (culture anaérobie.

12 Culture : délai d’incubation  De très nombreuses espèces bactériennes cultivent après 18 à 24 H d'incubation à 37°C.  D'autres espèces ont des délais d'incubation plus longs telles Mycobacterium tuberculosis (temps moyen d'isolement de l'ordre de 21 jours)  Les cultures sont examinées en notant la quantité de colonies obtenues de manière : l Semi-quantitative (rares, peu nombreuses, nombreuses, très nombreuses) pour les liquides de ponction. l Quantitative (104, 105, 106..../ml) pour les prélèvements urinaires et pulmonaires.  Autres éléments pris en compte sont : l Culture en aérobiose et/ou en anérobiose. l Aspect des colonies: la taille, la bordure et la coloration Présence d'une hémolyse (alpha, béta).

13 Culture : exemple d’isolement Pus sur une gélose au sang frais

14 Culture : Identification - Antibiogramme  L'identification et l'antibiogramme de la majorité des bactéries habituelles est alors précisé dans un délai de 18-24 h. l A l'aide de tests d'orientation rapide : oxydase, catalase, coagulase... l Par ensemencement d'une galerie biochimique adaptée : u Identification de Escherichia coli et Proteus mirabilis par un ensemble de réactions du métabolisme intermédiaire.

15 Quelquefois cette procédure est insuffisante pour l'identification d'une bactérie  Il convient de faire appel : l soit à des modalités classiques de recherche d'autres caractères bactériens tels la croissance sur certains milieux pour l'identification des sources de carbone permettant la croissance, le type respiratoire, le type fermentaire, le type antigénique… l soit à des modalités modernes telles l'amplification génique de certains gènes ou encore le séquencage d'autres (ARNr 16S).

16 Les autres moyens diagnostiques Produits bactériens

17 Recherche d'antigène soluble  Exemple d'une pneumopathie à Legionella pneumophila. l Le test immunochromatographique aide au diagnostic présomptif des infections à Legionella en parallèle avec la culture ou d'autres tests. u Les avantages de ce test sont : précocité (dès le début des signes), simplicité (sur urine), rapidité (en 30 minutes), diagnostic tardif (> 2 mois après les signes cliniques), même après un traitement antibiotique adapté, Donc bonne valeur prédictive mais ce test ne détecte pas les autres sérogroupes de L. pneumophila

18 Méthode moléculaire  Le principe en est simple puisqu'il consiste à amplifier un gène entier ou non avec des amorces spécifiques ou encore séquencé et comparé avec ceux déposés dans des banques.  L'intérêt de ces diverses méthodes se résume: l Gain de sensibilité (X 2 par rapport aux méthodes classiques) pour la recherche notamment des Chlamydia génitaux. l Simplicité et la rapidité d'exécution.

19 Un appareil de PCR et la révêlation UV d'un produit amplifié après électrophorèse sur gel. Biologie moléculaire : PCR = "Polymerase chain reaction" ou l'amplification génique  La PCR est la technique la plus utilisée pour la détection (amplification) de l’ADN et de l’ARN.  A partir d’une simple copie d’une séquence particulière d’acides nucléiques, cette séquence peut être spécifiquement amplifiée et détectée.  Couramment utilisée pour le diagnostic à partir du produit pathologique de germes de culture difficile, voire impossible, tel Chlamydia trachomatis.

20 1. Lyse des bactéries 2. Fixation de l ’ADN sur des billes de silice 3. Lavages 4. Elution de l ’ADN par de l ’eau ou du tampon EXTRACTION DE L’ADN BACTERIEN


22 R = reporter et Q = quencher Dénaturation de l’ADN à 95 °C La sonde se fixe vers 68-72 °C Les amorces se fixent vers 60 °C La Taq ajoute des nucléotides et détruit la sonde. Le reporter se retrouve dans le milieu et émet une fluorescence qui est détectée. DETECTION DE L’ADN AVEC DES SONDES D’HYDROLYSE TAQMAN

23 AMPLIFICATION PAR PCR Marqueur Marqueur de poids moléculaire Témoin négatif Témoin positif Echantillons

24 Biologie moléculaire : Séquençage  ADN: Séquence de 4 nucléotides l Purines: Adénine (A), Guanine (G) l Pyrimidines: Cytosine (C ), Thymine (T)

25 Cellule Noyau Chromosome ADN Matériel génétique

26 Un chromosome est comme une pelote de laine dont le fil est l’ADN Cellule Noyau Chromosome ADN L’information génétique est stockée dans les chromosomes

27 Cellule Noyau Chromosome ADN A T G C T A A T Un chromosome est comme une pelote de laine dont le fil est l’ADN

28 Cellule Noyau Chromosome ADN L’ADN est une chaîne composée de 4 « molécules » différentes symbolisées par les lettres A T G C A T G C T A A T

29 A T G C T A A T Cellule Noyau Chromosome ADN tgctgccatctacatttttgggactcgggaattatgtgagtaccgaaactactta gcttatggtaggtgtaccacacgcacagggaaagaattgcgtttatgtgggacag tgaaaacaatcgcaaaaaagcaatggaaagggctttgagagtaatttatcttctg acatatgcaatatggcaacttctaaatggtgagagggagtctctctaaagcaatc atttgaagattggttggacaaacaatgggaaagtcattgtcttagcagaattaag tcatactttttttttttttttttttttgctaactctagaagcttttctgttatct ctgtagctcagacgaaaatgcattctcaccagatgactgtttttggttaatcgat ctgaatgcgctttgtgtggactgtcgaatttcaaagatttaccgtatgaccaaga gcacctgatgctacaagtataaataggggaacaaatgctttctgttcttcctcgg taaggaggtagaggtggaggcggagccggatgtcagaggtcctgaaatagtcacc tgggggaaaatgatccgcctgctgttgaagcccccttctcattccgatcgctttt ggccttgatgatttgaaaataagtcctgttgcaccaggtaagtggacccaggtga gactctgtgatttctgcccataccctcatgtaggtgaccaatgtgactagctgtc ctgtgggggaaatatctccccagccattctgacacccacaggctggacacctgca ttccctagatctgcagaatctcagggagaaggggcattggagaggggatcgtttc ttaagccctttgctctctccctggagaccggtgttttcttctcttgttggaggtt tcagagactggggctccacaattgtcctgtcaatcctgaaggaggtcagatcctg gccaggaaatctctgagtcctccaggaagtcctgagaagcagtggccac 3 milliards de « caractères »… C A T G C T A A T

30 tgctgccatctacatttttgggactcgggaattatgtgagtaccgaaactactta gcttatggtaggtgtaccacacgcacagggaaagaattgcgtttatgtgggacag tgaaaacaatcgcaaaaaagcaatggaaagggctttgagagtaatttatcttctg acatatgcaatatggcaacttctaaatggtgagagggagtctctctaaagcaatc atttgaagattggttggacaaacaatgggaaagtcattgtcttagcagaattaag tcatactttttttttttttttttttttgctaactctagaagcttttctgttatct ctgtagctcagacgaaaatgcattctcaccagatgactgtttttggttaatcgat ctgaatgcgctttgtgtggactgtcgaatttcaaagatttaccgtatgaccaaga gcacctgatgctacaagtataaataggggaacaaatgctttctgttcttcctcgg taaggaggtagaggtggaggcggagccggatgtcagaggtcctgaaatagtcacc tgggggaaaatgatccgcctgctgttgaagcccccttctcattccgatcgctttt ggccttgatgatttgaaaataagtcctgttgcaccaggtaagtggacccaggtga gactctgtgatttctgcccataccctcatgtaggtgaccaatgtgactagctgtc ctgtgggggaaatatctccccagccattctgacacccacaggctggacacctgca ttccctagatctgcagaatctcagggagaaggggcattggagaggggatcgtttc ttaagccctttgctctctccctggagaccggtgttttcttctcttgttggaggtt tcagagactggggctccacaattgtcctgtcaatcctgaaggaggtcagatcctg gccaggaaatctctgagtcctccaggaagtcctgagaagcagtggccac Chez l’homme, L’information génétique est formée par un texte de 3 milliards de caractères unique pour chaque individu: « le génome humain » une séquence d’ADN…

31 Cellule Noyau Chromoso me AD N Un gène

32 mRNA virtuel Traduction en ‘protéine’

33 Séquençage de l’ADN  Définition : l Technique permettant de déterminer la séquence (ordre des nucléotides) d’une molécule d’ADN.

34 Séquençage selon Sanger  Polymérisation de l’ADN 5’ATGGCTATGCCGAGACCATATTACGACCAG 3’ 3’TACCGATACGGCTCTGGTATAATGCTGGTC 5’ Matrice A G T C C G A C G Polymérase Amorce Nucléotides (dNTP)

35 Didésoxyribo-nucléotides Désoxyribo-ntDidésoxyribo-nt 1’ 2’ 3’ 4’ 5’

36 Séquençage selon Sanger  Réaction de séquençage (ddGTP) 5’ATGGCTATGCCGAG 3’TACCGATACGGCTCTGGTATAATGCTGGTC 5’ Matrice A G T C G C A C G Polymérase Amorce dNTP + ddGTP


38 Gel d’Agarose Séquençage selon Sanger  Séparation des produits 5’ATGGCTATGCCGAG 5’ATGGCTATGCCG 5’ATGGCTATG Electrode - Electrode + Migration Electrophorèse

39 Séquençage selon Sanger Gel d’Agarose Migration Electrode - Electrode + ddAddGddCddT AGGCTATCTGAC 5’ 3’

40 Ordinateur Séquençage automatique

41 Séquençage nucléotide : méthode de Sanger  Liaison de l’amorce avec l’ADN à séquencer.  La fixation des ddNTP (désoxyNucléotide TriPhosphate) aux brins d’ADN va créer des brins de différentes tailles.  Les brins vont migrer sur un gel d’électrophorèse selon leur taille : le plus petit migre le plus vite.

42 Séquençage nucléotide : méthode de Sanger

43  Automatisation de la méthode : l Ajout sur les ddNTP de fluorochrome de différentes couleurs. l 1 seul tube regroupant les ddNTP. l Lecture par un laser des fragments qui migrent sur le gel. l Stockage des données dans la mémoire de l’ordinateur.

44 Séquençage nucléotide : méthode de Sanger


46 Diagnostic indirect ou sérologique  Le principe se base sur les conséquences induites chez l'hôte à savoir la production d'anticorps.  La réaction immunitaire ne se développe qu'à partir d'un délai, de l'ordre de 8 à 10 jours.  Techniques : Les anticorps sont recherchés, le plus souvent, dans le sang circulant après prise de sang, de l'ordre de 5 à 10 ml sur tube sec sans anti-coagulant.  Il existe diverses techniques pour déceler la présence d'anticorps: l Réaction d'agglutination.  Recherche d'anticorps par ELISA.  Recherche d'anticorps par immunofluorescence.  Recherche d'anticorps par une technique de révêlation utilisant les globules rouges

47 Une protéine: comment c’est fabriqué ?

48 Noyau de la cellule = Bibliothèque Chromosomes (ADN) = Livres de recettes (23 x 2 chez l’homme) Une cellule

49 Noyau = Bibliothèque 1 recette pour 1 protéine = 1 gène Chromosomes (ADN) = Livres de recettes Une cellule

50 Noyau = Bibliothèque Chromosomes (ADN) = Livres 1 gène = 1 recette Photocopie de la recette (ARN) Une cellule

51 Noyau Chromosomes (ADN) 1 gène = 1 recette Photocopie de la recette (ARN) Une cellule

52 Noyau Chromosomes (ADN) 1 gène Photocopie (ARN) Machine à fabriquer les protéines (ribosomes) Une cellule

53 Photocopie (ARN) Machine à fabriquer les protéines Une cellule

54 Photocopie de la recette Machine à fabriquer les protéines Une cellule

55 transcriptiontraduction Gènes: parties codantes de l’ADN Un gène est formé d’introns et d’exons Transcription et traduction

Télécharger ppt "DIAGNOSTIC D'UNE INFECTION BACTERIENNE. Généralités  DIAGNOSTIC DIRECT : mise en évidence de la bactérie elle- même, donc finalement de sa culture ou."

Présentations similaires

Annonces Google