La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Prise en charge du cancer colorectal à lheure de loncogénétique et des thérapies ciblées AIT-KACI.H, CHERID.MC, TERKI.N CPMC.

Présentations similaires


Présentation au sujet: "Prise en charge du cancer colorectal à lheure de loncogénétique et des thérapies ciblées AIT-KACI.H, CHERID.MC, TERKI.N CPMC."— Transcription de la présentation:

1 Prise en charge du cancer colorectal à lheure de loncogénétique et des thérapies ciblées AIT-KACI.H, CHERID.MC, TERKI.N CPMC

2 Les examens de BM réalisées à partir des tumeurs humaines peuvent permettre une optimisation de loffre de soins aux patients atteints de cancer. Létude à léchelon moléculaire des tumeurs peut permettre une thérapeutique ciblée, donc adaptée à chaque patient.

3 >

4 TESTS RER Le syndrome de Lynch aussi nommé syndrome HNPCC est un syndrome génétique héréditaire prédisposant aux cancers CR et de lendomètre. Lié à lexistence dune mutation constitutionnelle, ds le génome de lindividu, sur lun des gènes de la famille MMR. Gène MLH1 ou MSH2 ou MSH6 rarement PMS2

5

6 Il ny a pas de caractéristique clinique qui permet de reconnaitre aisément un syndrome de lynch ( KC âge jeune). Sur le plan tumoral il existe des caractéristiques non pathognomoniques (phénotype RER positif) Replicative ERror, temoin indirect dune altération dun gène MMR.

7 Plus de 95% des tumeurs CR développées dans le cadre dun syndrome HNPCC présentent un phénotype RER positif. 15% des tumeurs sporadiques présentent un phénotype RER positif. Les mécanismes menant à ce phénotype sont différents, il sagit dune altération somatique (au niveau de la tumeur et non pas au niveau du génome) dun gène MMR le plus souvent MLH1.

8 Deux types danalyses caractérisent le phénotype RER La recherche dinstabilité micro satellitaire. Lextinction immunohistochimique des protéines MMR.

9

10 Choix par le pathologiste dun bloc comportant tumeur + tissu sain -IHC : hMLH1 (clone G , 1:70) et hMSH2 (clone FE11, 1:100). hMSH6 (et hPMS2) à la demande Perte totale par les cellules tumorales exigée, avec témoins internes (cellules épithéliales et lymphocytes) positifs -PCR : 2 coupes de 10mm du même bloc sans macro-ni microdissection, extraction ADN, PCR pentaplexmononucléotidique(Suraweeraet al, Gastroenterology2002), MSI > 2 marqueurs instables

11

12 hMLH1hMSH2

13 Résultats IHC MMR MLH1 et MSH2 «systématiques» (pas de contexte) –Pas de perte : MSS, pas de Lynch –Perte MLH1 : Lynch MLH1 ou sporadique MSI –Perte MSH2 : Lynch MSH2 Contexte évocateur Lynch : –Perte MLH1 ou MSH2 : idem –Pas de perte MLH1 ni MSH2, faire MSH6 et PMS2 Perte MSH6 : Lynch MSH6 Perte PMS2 : Lynch PMS2 Pas de perte : sans doute pas Lynch (mais voir PCR MSI et consultation oncogénétique +++)

14 IHC Avantages : Oriente sur la protéine et donc le gène en cause Largement disponible Contrôle morphologique Inconvénients : Type et panel dAC variables Dépend de la fixation Sensibilité ne peut être parfaite

15 IHC cible un gène précis et permettra ensuite de centrer lanalyse sur ce gène

16 Immunohistochimie MMR JR Jass, 2005 : « The fact that the pathologist can contribute to the diagnosis of a serious disorder by using a strategy that is both simple and cost- effective represents an important medical advance » LA Aaltonen, 2006 : « Immunohistochemistry is the ideal method, there is no benefit doing both. MSI is control for IHC »

17 GCTTCACACACACACACACACACATCC GCTTCACACACACACACACACATCC GCTTCACACACACACACACATCC GCTTCACACACACACACATCC Instabilité micro satellitaire (MSI) En premier lieu, on étudie la stabilité des MSS, 2 statuts possibles MSI-L ( les MS sont soit stables ou très peu instables) MSI-H ( les MS sont très instables) Les MS sont de courtes séquences ADN formées de la répétition dun motif lui même constitué de une à quatre bases, les plus étudiés sont les répétitions (CA) Les MS étudiées sont BAT25, BAT26, NR21, NR24, NR27.

18 N N T T BAT26D17S250

19 PCR Avantages : Conséquence fonctionnelle de linactivation du MMR, indépendante du mécanisme. Caractère objectif (?) Inconvénients : Disponibilité limitée Non contrôle morphologique (?) Panel variable selon les centres

20 MORPHOLOGIE DES CANCERS MSI

21

22

23 KRAS-un biomarqueur pour les traitements anti-EGFR K-RAS est une protéine nœud de la signalisation intracellulaire. Elle fonctionne comme un interrupteur(actif liée au GTP et inactif liée au GDP). Les mutations kras se situent au niveau des codons 12 et 13 ( elles sont de type substitution de base et sont hétérozygotes).

24 Sur-expression EGFR ? (immunohistochimie) 1° biomarqueur prédictif potentiel évalué CCRm 75%- 90% EGFR+ : 30% répondeurs Tumeurs EGFR- : 25% répondeurs idem poumon Sur-expression des récepteurs GF PP P P Sur expression EGFR sans aucune valeur prédictive de la réponse aux anti-EGFR Facteurs prédictifs… et à part KRAS? Seuil de positivité = 1%

25 GF P P Cellule cancéreuse Activation incontrôlée GF et récepteurs GF voies de signalisation Dysrégulation gènes du cycle cellulaire Cellule normale GF et récepteurs GF voies de signalisation régulation des gènes qui contrôlent le cycle cellulaire prolifération autonome et dysrégulée prolifération régulée GF Effets des voies de signalisation intra- cellulaire Réparation et survie cellulaire par blocage apoptose Néo-angio genèse Division cellulaire prolifération Métastases invasion GF

26 Si KRAS muté = court-circuit dEGFR activation constitutive de la protéine KRAS non modulable par anti-EGFR Et KRAS dans tout ça? Croissance cellulaire non contrôlée Blocage EGFR sans intérêt P P GF KRASm

27 Etude immunohistochimique sur coupe en paraffine Indication du test RER: Nom et prénom: Age: Antécédent personnel: Autres: - Anti-hMLH1: - Anti-hMSH2: - Anti-hMSH6: - Anti-PMS2:

28 PHENOTYPE RER:. Cette analyse est effectuée sur de lADN extrait à partir dun fragment de tumeur Matériel analysé: tissu congelé/fixé dans du formol 10% Technique réalisée: ADN extrait: amplifiable MS analysés Bat26Bat25NR21NR22NR24 Phénotype Conclusion


Télécharger ppt "Prise en charge du cancer colorectal à lheure de loncogénétique et des thérapies ciblées AIT-KACI.H, CHERID.MC, TERKI.N CPMC."

Présentations similaires


Annonces Google