La présentation est en train de télécharger. S'il vous plaît, attendez

La présentation est en train de télécharger. S'il vous plaît, attendez

Développement et maturation des cellules lymphocytaires I- Les cellules B.

Présentations similaires


Présentation au sujet: "Développement et maturation des cellules lymphocytaires I- Les cellules B."— Transcription de la présentation:

1 Développement et maturation des cellules lymphocytaires I- Les cellules B

2 Développement des cellules B dans la moelle osseuse B Régule la construction d’un récepteur antigène Vérifie que chaque cellule n’a qu’une seule spécificité B Vérifie que les cellules B ne sont pas auto-réactives B Exporte des cellules à la périphérie B Site de production d’anticorps B

3 Cellules B Immatures & matures Sinus Central ProgéniteursPré-B Cellules du Stroma X X X EndoosteumEndoosteum Macrophage Schéma du développement des cellules B

4 Sécrétion de facteurs de croissance CYTOKINES 2. Sécrétion de cytokines par les cellules du stroma B Les cellules du stroma nourrissent les cellules B en développement Différents contacts cellulaires et différents types de cytokines sont nécessaires à chaque étape de la différentiation Cellules du stroma 1. Contact cellulaire spécifique entre les cellules du stroma et les cellules B Contact cellulaire

5 Cellules du stroma Cellules B en développement

6 B B Stromal cell

7 Périphérie Les étapes de la maturation des cellules B Cellules souches pro-B précoces pro-B tardifs grandes pré-B petites pré-BImmature BCellules B matures Chaque étape du développement est définit par des réarrangements des gènes codant pour les chaînes lourdes et légères des Ig, l’expression d’Ig de surface, l’expression de molécules d’adhésion et des récepteurs de cytokines

8 pro-B précoce Kit Récepteur Tyrosine kinase Facteur de cellules souches Facteur de croissance lié à la cellule VLA-4 (Integrine) Cellule souche Les différentes cytokines et les différents contacts cellulaires à chaque étape de la différentiation Cellules du stroma molécules d’adhésion cellulaire VCAM-1 (Ig superfamille)

9 pro-B précoce récepteur Interleukin-7 Cellule du stroma pro-B tardif Pré-B Interleukin-7 Facteur de croissance Les différentes cytokines et les différents contacts cellulaires à chaque étape de la différentiation

10 Les étapes de la différentiation sont définies par le réarrangement des gènes des Ig CELLULES B CONFIGURATION Des gènes IgH cellule souche pro-B précoce pro-B tardif grande pre-B Gène original D H - J H V H - D H J H VHDHJHVHDHJH Expression du récepteur Pré-B Les gènes de chaînes légères n’ont pas encore été réarrangés

11 B cell receptor Expression transitoire lorsque V H D H J H C H  est réarrangé VpreB/l5 – est nécessaire pour l’expression à la surface Ig  & Ig  Impliquées dans la Transduction du signal CHCH Chaîne lourde V H D H J H chaîne légère V L J L C L VpréB l5 Les ligands se fixant sur les récepteurs des cellules pre-B peuvent être: galectine 1, sulfate d’héparine, autre pre-BCR Pre-

12 Fixation du récepteur des cellules pre-B 1.Assure une seule spécificité anticorps par cellule Grande Pre-B Cellule du stroma ligand du récepteur des cellules pré-B 2. Contrôle l’entrée dans le cycle cellulaire EXCLUSION ALLELIQUE L’expression d’un gène sur un chromosome empêche l’expression de l’allèle sur l’autre chromosome 1. Empêche d’autre réarrangements des gènes de la chaîne lourde 2.Permet le développement des cellules pre-B possédant des jonctions V H D H J H dans un cadre de lecture correct

13 L’exclusion allélique empêche des réponses indésirables Empêche d’autres réarrangements des gènes des chaînes lourdes assurant une seule et unique spécificité anticorps par cellule Empêche l’induction d’une réponse non désirée par des pathogènes Y Y Y Y Y B S. aureus Un récepteur Ag par cellule Y Y Y Y Y Y Y Anticorps anti S. aureus Y Y YY B auto antigène Exprimé par une cellule de l’organisme (neurone) S. aureus Y Y Y Y Y Y Y Y Y Y Y Y Y Si deux récepteurs Ag par cellule Anticorps anti neuroneAnticorps anti S. aureus

14 L’exclusion allélique permet la sélection clonale Toutes les cellules doivent exprimer la même spécificité anticorps sinon la spécificité de la réponse immunitaire est compromise Comme d’autres réarrangements de gènes de la chaîne H ne peuvent avoir lieu l’émergence d’autre spécificités anticorps dans les cellules sœurs est empêchée après la sélection clonale S. typhi

15 L’exclusion allélique permet d’avoir un répertoire complet Ig anti-neurone B Exclusion des cellules B anti- neurone i.e. auto-tolérance Y Y B B Un récepteur Ag par cellule B Délétion Anergie OU B Ig anti-neurone ET Ig anti-S. aureus Y Y Y Si deux récepteurs Ag par cellule S. aureus Les cellules B anti S. aureus seront exclues laissant un répertoire incomplet Y Y Y B B

16 Fixation du récepteur des cellules pre-B 1.Assure une seule spécificité anticorps par cellule Grande Pre-B Cellule du stroma ligand du récepteur des cellules pré-B 2. Contrôle l’entrée dans le cycle cellulaire 1. Empêche d’autre réarrangements des gènes de la chaîne lourde 2.Permet le développement des cellules pre-B possédant des jonctions V H D H J H dans un cadre de lecture correct

17 cadre de lecture 1 MKXLWFFLLLVAAPRWVLSQV HLQESGPGLGKPPELKTPLGD TTHTCPRCPEPKSCDTPPPCP RCPEPKSCDTPPPCPRCPEPK SCDTPPPCXXCPAPELLGGPS VFLFPPKPKDTLMISRTPEVTC VVVDVSHEDXXVQFKWYVDG VEVHNAKTKLREEQYNSTFRV VSVLTVLHQDWLNGKEYKCKV SNKALPAPIEKTISKAKGQPEE MTKNQVSLTCLVKGFYPSDIAV EWESNGQPENNYNTTPPMLD SDGSFFLYSKLTVDKSRWQQG NIFSCSVMHEALHNRYTQKSLS LSPGK* séquence nucléotide de IgG3 H humaine ATGAAACANCTGTGGTTCTTCCTTCTCCTGG TGGCAGCTCCCAGATGGGTCCTGTCCCAGG TGCACCTGCAGGAGTCGGGCCCAGGACTGG GGAAGCCTCCAGAGCTCAAAACCCCACTTGG TGACACAACTCACACATGCCCACGGTGCCCA GAGCCCAAATCTTGTGACACACCTCCCCCGT GCCCACGGTGCCCAGAGCCCAAATCTTGTG ACACACCTCCCCCATGCCCACGGTGCCCAG AGCCCAAATCTTGTGACACACCTCCCCCGTG CCCNNNGTGCCCAGCACCTGAACTCTTGGG AGGACCGTCAGTCTTCCTCTTCCCCCCAAAA CCCAAGGATACCCTTATGATTTCCCGGACCC CTGAGGTCACGTGCGTGGTGGTGGACGTGA GCCACGAAGACCCNNNNGTCCAGTTCAAGT GGTACGTGGACGGCGTGGAGGTGCATAATG CCAAGACAAAGCTGCGGGAGGAGCAGTACA ACAGCACGTTCCGTGTGGTCAGCGTCCTCAC CGTCCTGCACCAGGACTGGCTGAACGGCAA GGAGTACAAGTGCAAGGTCTCCAACAAAGCC CTCCCAGCCCCCATCGAGAAAACCATCTCCA AAGCCAAAGGACAGCCCGAGGAGATGACCA AGAACCAAGTCAGCCTGACCTGCCTGGTCAA AGGCTTCTACCCCAGCGACATCGCCGTGGA GTGGGAGAGCAATGGGCAGCCGGAGAACAA CTACAACACCACGCCTCCCATGCTGGACTCC GACGGCTCCTTCTTCCTCTACAGCAAGCTCA CCGTGGACAAGAGCAGGTGGCAGCAGGGGA ACATCTTCTCATGCTCCGTGATGCATGAGGC TCTGCACAACCGCTACACGCAGAAGAGCCTC TCCCTGTCTCCGGGTAAATGA Les grandes cellules pré-B nécessitent des jonctions V H D H J H dans le cadre de lecture correct pour devenir matures cadre de lecture 2 (pas de protéine) * cadre de lecture 3 ETXVVLPSPGGSSQMGPVPGA PAGVGPRTGEASRAQNPTW* grande pre-B Développement continue récepteur Pre-B peut être activé Arrêt du développement

18 G Pre-B G Pre-B Large Pre-B Large Pre-B G Pre-B Large Pre-B Large Pre-B Large Pre-B G Pre-B G Pre-B Prolifération La fixation du récepteur pré-B contrôle l’entrée dans le cycle cellulaire grande pre-B Nombreuses grandes pré-B ayant des récepteurs pré-B identiques Large pre-B chaîne VDJC H intracellulaire Réarrangement V L -J L Arrêt de la prolifération récepteur Pre-B non pourvus petite pre-B Y B Immature Expression de la chaîne légère : IgM à la surface IgM

19 VDJCDJVCDJVCDJ V Lignée germinale Jonction D H -J H Jonction V H -D H J H VJCVCJ V Lignée germinale Jonction V L -J L Les réarrangement des chaînes lourdes et légères génèrent des pertes grande pré-B petite pré-B Deux jonctions aléatoires soit 1/9 de chance d’être dans le cadre de lecture Une jonction aléatoire, 1/3 de chance d’être dans le cadre de lecture Au total 1/27 de chance d’être dans le cadre de lecture Les cellules B qui ne sont pas dans le cadre de lecture arrêtent leur maturation

20 Les cellules B ont plusieurs possibilités pour réarranger correctement les gènes Ig Pro B précocePro B tardif Pré B V H -DJ H premier chromosome V H -DJ H second chromosome B Immature non oui non B  premier chromosome  second chromosome premier chromosome second chromosome non oui non oui Y IgM  B Y IgM B D H -J H premier chromosome D H -J H second chromosome oui non

21 B Y Y Y Y B petite pré-B Pas de récepteur Ag à la surface Incapable de détecter un Ag dans son environnement Peut être auto-réactive Cellule B Immature Ig exprimée à la surface Capable de détecter un Ag dans son environnement L’auto-réactivité doit être testée L’acquisition d’une spécificité antigénique nécessite de vérifier que les auto antigènes ne sont pas reconnus 1.Élimination Physique du répertoireDELETION 2.Paralysie des fonctionsANERGY 3.Altération de la spécificitéRECEPTOR EDITING

22 Auto-tolérance des cellules B : délétion clonale cellule B immature reconnaît des auto Ag MULTIVALENT B délétion clonale par apoptose Y Y B B Immature B petite pre-B petite pre-B Assemble les Ig

23 Y B Y Y Y B cellule B anergique IgD normal IgM faible cellule B immatures Reconnaît des auto- Ag soluble Pas dagglutination Y Y B B Immature B petite pre-B Petite pré-B assemble Ig IgM IgD Auto-tolérance des cellules B : anergie

24 Édition des récepteurs Un réarrangement codant pour un récepteur spécifique d’un auto antigène peut être remplacé VCDJ VVV Y B B !!Récepteur Reconnaît un Auto antigène!! B Apoptose ou anergie Y B B Le nouveau récepteur Reconnaît un antigène différent et sera testé à nouveau CDJ VVVV Arrêt du développement et réactivation de RAG-1 et RAG-2

25 Y Y Y Y Y Y Cellule B mature exportée à la périphérie Y Y IgD and IgM normal IgM IgD IgM cellule B immature Ne reconnaît aucun auto Ag Y Y B B Immature B petite pre-B petite pré-B assemble Ig B Auto-tolérance des cellules B : exportation

26 Production simultanée d’IgM et d’IgD: épissage des ARN Cm1 Cm2Cm3Cm4 Cd1Cd2 Cd3 pA1 V D J Cm1 Cm2Cm3Cm4 Cd1Cd2 Cd3 V D J AAA ARN,coupé et polyadenylation à pA2 V D J Cm IgM mRNA V D J Cd IgD mRNA Cg1Cg3CdCm V D J Cm1 Cm2Cm3Cm4 Cd1Cd2 Cd3 ADN pA1 pA2 V D J Deux ARNm peuvent être produits par l’utilisation de sites de polyadenylation alternatifs et épissage de l’ARN ARN épissé et polyadenylation à pA1 AAA

27 CD21 (C3d récepteur) CD19 CD81 (TAPA-1) IgaIgb CD45 co-récepteur cellule B Les co-récepteurs des cellules B

28 Src (kinase) se lie à CD19 phosphorylé Reconnaissance de l’antigène Bactérie opsonisée C3d Ig membranaire et CD21 sont liés de manière covalente par un antigène qui a activé le complément C3d se lie à CD21, récepteur 2 du complément (CR2) P P CD21 est phosphorylé et la kinase associée au récepteur phosphoryle CD19 PP Phosphorylation des Co-récepteurs CD19 phosphorylé active d’autres kinases Src La fixation du co-récepteur augmente le signal de ,000 fois

29 Différentiation des cellules B à la périphérie cellule B reconnaît Un antigène Du non-soi dans la périphérie sécrétion d’Ig par les cellules du plasma Y Y Y Y Y Y Y Y Y B YY Y Y Y Y Y B YY Y Y Y Y Y B Cellule B mature périphérique

30 Cellules B du plasma Switch isotype B B cellule B Mature cellule B Plasma élevé oui non oui oui oui faiblenon oui non non non Surface Ig Surface MHC II sécrétion Ig haut débit croissance hypermutation somatique

31 Circulation des cellules B à travers les organes lymphoïdes cellules B sanguines lymphe Canal efférent Zone cellule T Zone cellule B

32 Les antigènes entrent dans les ganglions par le canal afférent Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Les cellules B entrent dans les ganglions via veinules endothéliales Les cellules B prolifèrent rapidement CENTRE GERMINATIF structure transitoire d’intense prolifération centre germinatif production de cellules B différentiées en cellules du plasma Les cellules B circulantes attrapent des antigènes étrangers dans les organes lymphoïdes

33 Association des antigènes avec les cellules folliculaires dendritiques (FDC) Les antigènes entrent dans le centre germinatif Sous forme d’un complexe immun avec C3b et des anticorps attachés récepteur 3 du complémentrécepteur Fc des Ig FDC surface Les dendrites filiformes des FDC développent des perles recouvertes de fines couches de complexes immun Le complexe immun se fixe aux récepteurs Fc et aux récepteurs du complément sur les FDC

34 Follicules Primaires se transforment en follicules secondaires lorsque les centres germinatifs se développent zone sombre zone claire B T FDC sélectionne les cellules B Micro-anatomie du centre germinatif 1. Cellules B (centroblastes) répriment les Ig de surface, proliférent et hypermutent somatiquement leurs gènes Ig MATURATION DE L’AFFINITE 2. cellules B (centrocytes) activent les Ig de surface, stoppent leur division et reçoivent des signaux stimulant des cellules T et FDC 3. Apoptose des cellules auto-réactives & des cellules non sélectionnées 4. Les cellules sélectionnées quittent la lymphe soit comme cellules mémoires soit comme cellules plasmatiques

35 CD5 Deux lignées cellulaires pour les lymphocytes B B Précurseur cellule B B cellule B mature cellules B B2 Cellule B du plasma Y Y Y Y Y Y Y Y Y PC IgG B Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y IgM – un seul isotype B précurseur cellule B distinct ? ? cellules B B1 cellules B ‘ Primitives’

36 CD5 B Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y IgM Les cellules B B-1 Les IgM utilisent des régions V différentes & en nombre restreint Reconnaissent des épitopes Ag répétés comme les phospholipides, la phosphotidyl choline & les polysaccharides Ne font pas partie de la réponse adaptive : pas de mémoire induite pas d’augmentation lors de la 2 ème infection Présent dès la naissance Peu de régions de nucléotides N (aléatoires, non codés) dans les IgM ANTICORPS NATUREL Produisent des Ig sans l’intervention des cellules T

37 Comparaison des propriétées des cellules B-1 et B-2 PropriétésB-1 B-2 régions N peubeaucoup région répertoire V RestreintDiverse LocalisationPéritoine/plèvrepartout Renouvellementauto in situmoelle osseuse production spontanée d’Ig élevéefaible IsotypesIgMIgM/G/A/D/E Spécificité polysaccharides ouiRare spécificité protéines Rareoui Besoin de cellules TNonoui Hypermutation somatiqueNonélevé developpement mémoireNonoui Oui Rare Rare Oui Non Oui Spécificité polysaccharides Spécificité protéines Besoin de cellules T La spécificité & la nécessite de l’aide de cellules T suggèrent que les deux types de cellules B détectent des antigènes différents

38 Antigènes indépendant des cellules T (TI-2) cellules B immatures se fixant à des auto Ag multivalents sont conduits en apoptose Le répertoire de cellules B-2 est purgé des cellules reconnaissant les Ag multivalents durant leur développement dans la moelle osseuse Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y IgM Y Y Y Y Y B-1 Mature Y Y B-2 Immature Les cellules B-1 non dérivées de la moelle osseuse sont directement stimulées par des antigènes contenant des épitopes multivalent Les cellule T ne sont pas nécessaires Induisent l’expression d’anticorps naturels spécifiques des Ag TI-2 Antigène TI-2

39 LPS LPS binding Protéines (LPSBP) CD14 Cellule B Les lipopolysaccharides bactériens, (LPS, antigènes TI-1), se fixent sur les LPS binding protéines de l’hôte dans le plasma Le complexe LPS/LPSBP sont capturés par CD14 sur la surface des cellules B TLR 4 Le récepteur 4 (TLR4) interagie avec le complexe CD14/LPS/LPSBP Activation des cellules B Antigènes indépendant des cellules T (TI-1)

40 YYYYYY BBBBBB YYYYYY YYYYYY YYYYYY YYYYYY YYYYYY YYYYYY Six cellules B différentes ont besoin de 6 antigènes différent pour être activés A forte dose les antigènes TI-1 (LPS) vont ACTIVER DE MANIERE POLYCLONALLE toutes les cellules B cells sans respecter leur spécificité Les antigènes TI-1 sont des MITOGENES LPS se complexe avec CD14, LPSBP & TLR4 Antigènes indépendant des cellules T (TI-1 - LPS)

41 Maturation des cellules B - résumé

42 La réponse immunitaire

43

44

45 Développement et maturation des cellules lymphocytaires II- Les cellules T

46 La maturation thymique

47 Les thymocytes exprimant les TcR qui reconnaissent les antigènes du CMH sont retenus Sélection positive Sélection négative Les thymocytes exprimant les TcR qui reconnaissent des auto-antigènes présentés par des récepteurs du CMH ou qui n’ont pas d’affinité pour les auto- récepteurs du CMH sont éliminés

48 Le complément

49 synthétisées majoritairement dans le foie souvent des proenzymes (ou zymogènes) –dénomination selon l’ordre de découverte pas nécessairement selon un ordre logique (malheureusement!) –activation par protéolyse avec séparation d’un fragment inhibiteur et d’un fragment catalytique Les protéines du complément Système complexe de plus de trente protéines plasmatiques et membranaires

50 Fragment inhibiteur –le plus petit –appelé...a –action à distance sur l’activation et le chimiotactisme des phagocytes Fragment catalytique (sérine protéase) –le plus gros –appelé...b –action enzymatique locale (à la surface de l’agent pathogène) Les protéines du complément

51 La molécule effectrice la plus importante du système Le facteur soluble le plus important du système

52 C4b et C3b : les systèmes d’ancrage

53 Collectines : molécules ancestrales à activité lectine Interagit avec plusieurs ligands mais en particulier avec des ligands présents sur les immunoglobulines et en particulier sur les complexes immuns Activation : reconnaissance d’un antigène par un anticorps spécifique –formation d’un complexe immun La portion Fc d’une immunoglobuline libre (sans antigène fixé sur le Fab) est incapable de lier C1q. Voie classique : intervention de la collectine C1q

54 C1 est formé de trois molécules distinctes –C1q : dépourvu d’activité enzymatique, se lie au domaine Fc des IgM et des IgG –C1r : sérine protéase –C1s : sérine protéase Voie classique : le complexe C1

55 Le complexe C1

56 Le complexe C1r 2 C1s 2 non lié à C1q est inactif C’est la fixation sur C1q qui révèle l’activité enzymatique de C1r Non fixé sur C1q Fixé sur C1q Domaines d’interaction avec C1q Voie classique : le complexe C1

57 C1 = protéine avec un domaine de type collagène et un domaine lectine C1 est une COLLECTINE.

58 Pour que C1r 2 C1s 2 puisse se lier à C1q, il faut que C1q subisse lui-même un changement de conformation La fixation de C1q, notamment sur des complexes immuns permet ce changement de conformation Le complexe C1 Complexes immuns à IgM –les IgM sont des pentamères –chaque molécule d’IgM possède au moins trois sites de fixation au C1q les IgM activent très efficacement le complément –Les sites de fixation au C1q ne sont exposés que si l’IgM est liée à un antigène

59 La liaison de C1q à deux Ig ou plus n’est possible que si ces dernières appartiennent à un même complexe immun ou si elles sont fixées sur une même surface Le complexe C1

60 Liaison de C1q à des Ig

61 Constitution de C1qr 2 s 2 C1s est le substrat de C1r et est lui- même une protéase Liaison de C1q à des Ig

62 C2 et C4 sont deux substrats de C1s C4b intervient dans l’ancrage à la membrane b C2a 2b C4b2b Constitution de la C3 convertase

63 b C2a 2b C4b2b C4b intervient dans l’ancrage à la membrane Constitution de la C3 convertase

64 Liaison thioester avide d’électrons Hydrolyse de C3 par la C3 convertase (très efficace)

65 Liaison covalente avec les glycoprotéines de la surface cellulaire Hydrolyse de C3 par la C3 convertase (très efficace)

66 2b Constitution de la C5 convertase

67 2b2b Tout le C3b ne se lie pas à la membrane Une partie diffuse et se fixe sur des complexes immuns solubles et des microorganismes : opsonisation Génération d’une grande quantité de C3b qui couvre la surface bactérienne

68 Une molécule de C4b2b clive 1000 molécules de C3 en C3b!

69 2b Activation du MAC (membrane attack complex) (C5-C9)

70

71

72 Le MAC est important contre un nombre limité de bactéries (neisseria notamment) Par contre l’opsonisation par C3b est cruciale pour un grand nombre d’agents infectieux. Importance relative du MAC et de la génération de l’opsonine C3b

73 La voie classique peut parfois être activée via C1q mais par autre chose que des complexes immuns Certaines bactéries (certains steptocoques) Cellules apoptotiques Dans certains cas C1q peut se lier directement à certaines cellules Dans d’autres cas, C1q est activé par une protéine qui n’est pas une immunoglobuline : la CRP

74 Protéine de la phase aiguë de l’inflammation (acute phase protein) Synthétisée par le foie Marqueur de l’inflammation très couramment utilisé en biologie clinique CRP : C Reactive Protein

75 Membre d’une famille de protéines très ancienne Se lie à la phosphocholine et aux résidus phosphocholine des polysaccharides bactériens Se lie aux cellules apoptotiques Une fois lié à son ligand, peut activer le C1q

76 protéines ou glycoprotéines capable de se lier à certains résidus glucidiques origine non immunitaire capable comme un anticorps d’agglutiner ou de précipiter des cellules ou des glycoconjugués isolées initialement chez des végétaux mais molécules voisines (lectin-like) présentes chez les bactéries et les animaux Lectines

77 Domaine de type lectine (site de la liaison au résidus mannosyl et fucosyl) Liaison à de nombreux microorganismes Gram-, Gram+, mycobactéries, champignons, parasites Le récepteur au mannose et sa famille

78 Fait intervenir la MBP (mannose binding protein), une collectine de la même famille que C1q MBL est donc l’équivalent de C1q Une fois liée, la MBP recrute une protéase (la mannose binding protein associated protease ou MASP) qui est l’équivalent de C1s et dont les substrats sont C4 et C2 Voie d’activation par la lectine liant le mannose (MBL)

79 Voie de MBL

80 Non liée à la fixation d’une collectine sur un complexe immun ou sur un pathogène donc indépendante de l’immunité adaptative Considérée comme constituant de l’immunité naturelle Aboutit à l’activation du MAC (formation de C5b sans l’intervention d’anticorps) Voie alterne

81 Facteur B : une fois fixé sur C3b, devient le substrat du facteur D (protéase équivalent de C1s) C3Bb : C3 convertase de la voie alterne Properdine : augmente la ½ vie de la C3 convertase de la voie alterne (5  30 minutes) Voie alterne

82 Présence physiologique de petites quantités de C3b dans le plasma (hydrolyse spontanée à bas bruit de la liaison thioester instable) Fixation de C3b sur toutes les cellules (y compris les cellules de l’hôte) Voie alterne

83 Régulation étroite de la voie alterne sur les cellules eukaryotes

84 CR1 et DAF : empêchent l’interaction C3b B et déplacent C3b des complexes C3bBb déjà formés Facteur I : protéase plasmatique qui clive C3b en iC3b CR1, DAF et facteur H sont des cofacteurs du facteur I L’activité du facteur H dépend du contenu cellulaire en acide sialique Régulation de la voie alterne

85 Voie classiqueVoie alterne

86 Voie classique vs. voie alterne

87 La voie alterne constitue une boucle d’amplification de la voie classique

88 Classique : intervention de C1q –Via COMPLEXES IMMUNS : le plus souvent –Via CRP (polysaccharides bactériens, cellules apoptotiques) –Directement (certaines bactéries, cellules apoptotiques) Les trois modes d’initiation de la cascade du complément

89 Alterne : pas d’intervention de C1q –Nombreuses bactéries, champignons, virus, cellules tumorales Mannose binding lectin –Microorganismes qui contiennent des groupes mannoses terminaux Les trois modes d’initiation de la cascade du complément

90 Lié à la membrane peut se produire à la surface d’une cellule ou sur des complexes immuns! MAC

91 Attention : si le MAC est activé par des complexes immuns libres (non cellulaires), le C5b67 peut aller se fixer sur des cellules voisines (qui n’ont pas d’antigène à leur surface) –innocent bystander lysis MAC

92 Lié à la membrane C5b678 peut suffire à lyser une hématie mais pas une cellule nucléée 10 Å MAC

93 100 Å Activation du MAC (membrane attack complex) (C5-C9)

94 Une activation intempestive du complément peut tuer un individu ou altérer gravement ses organes –molécules très labiles une fois activées –nombreux systèmes de contrôle La régulation du complément

95 L’inhibiteur de C1 (=inhibiteur de C1 estérase)

96 Déficit génétique : activation intempestive de C4 ou de C2 L’inhibiteur de C1 (=inhibiteur de C1 estérase)

97 Famille de protéines (toutes codées par le même chromosome) et qui régulent l’activité de la C3 convertase –voie classique : se lient à C4b une protéine soluble : C4BP deux protéines membranaires : CR1 et MCP une protéase qui inactive C4b en C4d et C4c Les protéines RCA (regulator of complement activation) –voie alterne : se lient à C3b trois protéines membranaires : CR1, MCP, facteur H une protéase qui inactive C3b en C3c et C3dg –inhibent sa formation –favorisent sa dissociation (decay) C4BP, CRI, facteur H DAF (decay accelerating factor)

98

99 Protéine S (vitronectine) –protéine soluble qui lie le complexe C5b67 et l’empêche de s’insérer dans la membrane cellulaire Inhibition du MAC

100 Homologous restriction factors (spécificité d’espèce – se lient à C8) –HRF –CD59 Inhibition du MAC Déficit d’ancrage GPI : hémoglobinurie paroxystique nocturne

101

102 Conséquences de l’activation du complément

103 bactéries Gram - virus enveloppés herpesvirus, retrovirus,... Conséquences de l’activation du complément

104 peu efficace contre les bactéries Gram + et les cellules nucléées (notamment tumorales) Conséquences de l’activation du complément

105 Neutralisation de certains virus par la fixation de certains composants du complément indépendamment de l’activation du MAC Conséquences de l’activation du complément

106 Principale opsonine : C3b Conséquences de l’activation du complément

107 Principale opsonine : C3b Récepteur CR1 Conséquences de l’activation du complément

108 Le C3b et les hématies (riches en CR1) interviennent pour éliminer les complexes immuns via les cellules phagocytaires de la rate et du foie Solubilisation des complexes immuns

109 C3a, C4a et surtout C5a sont des anaphylatoxines, des facteurs solubles qui initient la réponse inflammatoire –provoquent la dégranulation des basophiles et des mastocytes tissulaires et la libération d’amines vasoactives (en particulier d’histamine) vasodilatation, augmentation de la perméabilité vasculaire, contraction des muscles lisses bronchiques –induisent l’adhérence des neutrophiles et des monocytes au cellules endothéliales, leur extravasation, et leur activation sur le site inflammatoire Réponse inflammatoire

110 –activité régulée par une protéase la carboxypeptidase N –les formes des-Arg ont perdu l’essentiel de leur activité Réponse inflammatoire

111

112 Test immunologiques

113

114

115

116

117

118

119

120

121

122

123

124

125

126

127

128

129

130 Essai immunologique

131

132

133

134

135

136

137

138

139

140

141

142

143

144

145

146

147


Télécharger ppt "Développement et maturation des cellules lymphocytaires I- Les cellules B."

Présentations similaires


Annonces Google